guanine nucleotide binding protein-like 3 (nucleolar)-like

cDNA: Genbank AY648737

 

hi1437 and hi3439 are both in the 1st intron

 

tttaaaataaaattacaataaatacaattacatatataatctaaaacaat

aagtaaaaataaaaatacttgagggcacatggcaaggagtgcaaaccaga

gttgtgcaggtgcaaaacggtatatagtgtaaaaagtacagtataatgta

aaaaaaaatatatagtgcaaaacgcttgaaagtgtgataaatatgataac

ttgctggccatacaatatagttttagtttagttaaaaaaacaactattat

ttagatcaggaattcagattgagattcagatgaaaacgtgtacgggttaa

gtcttgtattgacgatgtaatatcgaaattcatgatttacatttgacaag

atttacttttaacctacagtctatggaactcaccgtgctggtttcaaccg

TCCAATACTGTCGACTTTTATTTTGAAAGCCCGTCGTGTGTCGAAGTCTT

CACACACACTAGCACTTTAAAGCATTTAACGTTACACGTGCAGTCATGTC

CAAAGCAAgtgagtaacatatct

hi3439 (5-3)

ctcacactttctatttaaagcgagcgttaaaaagatctgttgacacaaat

gattttacttattaatat

hi1437 (3-5)

acgttcactatgttacagAGCAAAAGCGAGCGAAACGCCTGGGATTTTGT

GGTAAAAAGgtgcgtgacatagccttcatgctaacttactgacgcatcaa

cgttgcgcttatttgtattgaaaatattgtgctgtagaaaagttatagac

ctagaaactgtagcgttaccagtcaaatgttagggcattttcatatgttg

ttgttaatgcagcaatgcctgata