60S acidic ribosomal protein P1

cDNA: Genbank AY561519

 

hi1444, hi3653b, and 3988 are all in the 1st intron

 

ctcattcattcattcactagtcagcgctgtcgtgagcacatgtacacagc

gaataactgacatcacaaacgaaccaatcacagcttttgttttcttcact

tgtctcgcccactgaagtgacgcacaagtctatataagtcttcgctccac

ccttttccggccctttccgttcactgagatcgcagcatttgaggtgctCG

GTTCTTCTCCCGAAGCTAAGGCCTTCAATCCGGCGACTAGCACCGTCAAA

TTTGCCCATCCGCACCAAAAAACTTAACCTACCGAAAGAACGATGGCATC

TGTGTCCGAACTCGCCTGTATTTACTCCGCTCTGATCCTCCACGACGATG

AAGTTACCGTCACGgtgagtgttgagctcct

hi3988 (5-3)

aacaggcgaaacgtgaacatccgggacccaaccgctacggttctcgcatg

ctaccctgatttttgtgttaatttaatatttctgcgtttgctagttcatt

acatcacgtgtttggtgtgttattagatagttaagtcgctgtgtttgtgc

gaatagtagtaagcacgttatagcacattttcgcgcgcttcctgtcatta

tcctgtacggcttaaatacttcagataaatgttcacattgtgactgtaga

tacactataactaaagctgaaatacttcagataaatgttcacattgtggc

tgtaaacacgcataactaaacgtactagctatcagcacctggtagcatcc

ctgtatcatgctaatgacacattaacactttagctagtaggctaaagact

agataagttggtcagttgacatgtgctgg

hi3653b (3-5)

tattcattaatacagtatttcctaaataagcatgcattagttatcatggt

catgtaaaaagtgtaaatatttaagctttacactgtcttttaaaagttta

ttctttttacaccttaaagcaagactcaattaatgatgttgtgaaaagta

cgtgtgtagttcattcatcttagttgagattgtttacaagtgtttttttt

tattgacagtttttagttgaataactgcaccaatgtagcatattcgttaa

ggtttatatcttgttatttgctgaataagaccataatccaagtacttcaa

ttcttaccaatgcatgaaaaatagttatagtccatgtccaagtagtctat

caagataaaacatgtagactattttgagggatgtaaacaaaaaataaggt

tccaacatgtttccagttttacattttaaatttgtatagcttccaagaac

taaaaattgatagttatgatagctgttttaacattaagttatgattgaac

tgcctgttacagtaattaaatggtttgataagcaggaaatgttcacggcc

aatgacatgaccacattgaaatggtctaattatatatatgatttgcactt

agtcaattaattatttttctgatgttgttttaataactcagtgtatattc

taataacaaacatcacaatcaaaactttcaccaacaagtgaatgagacta

ttagaggtgaatttaaagcatgttcgggggcg

hi1444 (3-5)

taatgacctacaaatattattgtagcatctcaaaaaccataaccttacaa

ataattttgctgctttgatctgatcgctgctattgtcttgcacagtattt

gcattaaatgagttgatgcactgatatgaactctctctaattttgttttt

cagGAGGACAAGCTGAACGCTCTGATCAAGGCTGCCGGTGTGACCATCGA

ACCCTTCTGGCCTGGTCTCTTCGCTAAGgcaagtttatttcacatctgac

aggaggatgatggagagataaatgtgaatgccttccatcattaagtcctc

atgctgtagtgcaggggtgctcgaactcagtcttggatggct