DEAD (Asp-Glu-Ala-Asp) box polypeptide 54

cDNA: Genbank AY099535

 

hi1447 is in the 1st intron

 

tattaatgaaatattcgtgctttaataatcgtgtttcatgcgccaccgcg

cggtccacctctgaactgcagcagcggcgcgctctggcgtcatctctacg

CGCCGAGACGCGCGCACACGTGTCTCACTAGCGTCTGCGGTGTTTTCATC

GCACATTTCTTTAATTTCCTCGATTATCTACCATCCTTTAGAGCTTCAGA

AATGGCCCAGAGAAAGAAAAAGCTGATGAGGAGGAAGAAAAGCGGCGCAA

ACCGCGATCACGAGCTCCAGTCCGACGATGAAGAGTTTGAGGTGGCCGCA

GGAGTCAAAGATGACGAAAATACCgtgagtttcacacgctttctgtcgga

gagtcaccgattatgtgtgtgttttctttaagtcgtcaactgattcagct

gtggagactcaaatattaacacaagattccccatccaccgataaaagtgg

acatttgtagagctttaacatgatttctcctccaacattagac

hi1447 (5-3)

aagctgagaacatatgagctgtcatgtttccctgatcagtttaagaaaac

agacactgagatatgagacagtagtgtataaccacccaaatgctgctttt

gagacttgttgctgac

 

approx 1.3 kb to next exon