WD repeat domain 46

cDNA: Genbank NM_200623

 

hi1451 is in the 1st intron

 

agatctgcttttaccattatgctgccagtgttacattcacttttaatgaa

gccgcattaaaggtttgctgcattcaaatgataaatttttttcagcttag

actcttattagtcaggggtctgcacagtggaatgaaccgccaactattcc

agcatatgttttacgcagcggatgcccttccagctgggaaacacccacca

ttcacacacacgctcatacaatacggccaatttagttcatcaattcccct

atagcgcatgtgtttggactgtgggggaaaccagagcactcggaggaaac

ccacatcaacacggggagaacatgcaaactccacacaaaaacgtcaactg

acccagccggcattcacccagcgaccttcttactgtgaggccacagtgtt

aacctggcacaccatgcagccaggtttcttttaattaactaataaaaaac

aattgttaaattaaatattaaaatatatttaaacttatttcaactacgtt

gccgagtagtaaaagctaaagctagcttttagccatagcgctacttctct

cttttatgtagctactaaagctaacaaaaacactcaatataattgctaaa

gcttcaaatgaagtggcataacagtaaaactaattcataatatttaaaaa

aaatgatagtatgtggatttagtgcaacatttaaacatttgcggatcata

taataatagatcagcgggtgtcaagtgaataacagtgatcgccatgaccg

tcagtccagcagaaggcgctgattcgctcgtcagctgttatgatcgccgc

caacaatcgacgaagaagaacggattcAACGCTTTCAAACAAACATGGCG

GCGCAGGAGGTGTTGACGGCTTCACACGTGGAGAAAAAGGCAAAGAAAAA

Ggtgaatttaatttatccggctttcactgcaataatacccgcttaattat

agcggtgtgaatctatttgttcatatcagagagtcaaagacactcgctgt

gaagacgctgtcaacaaataaaagtcccctcgttcgctgatttcagcttt

attctgttacaatcgacatgtcgtgtgatttaatcctatttttactgtcg

attattaatttaatgtgacaagaatacatttatcacttacttgtatatgg

cttatcttgtacaattcggttcacggttgtctgcaatcacaataatgcag

aaaagttgttgtttacctgatac

hi1451 (5-3)

ttatgcagattcacagagtcagcgatatatattatgtaggtttatataat

atgtgatttttaaaattaaaattaattgaataagtcactaaattctaaga

ctagaatatattaagtatgtatttattatattgttaccaaaacagtgcct

caataatgctcttagatttttttaaatacatttagtctgtattaaacgtg

ccttttaaaatcccaatagcatcagaaagtgctgtattaatgtttaataa

tgtgtttattcactactatttgacatatcaaagtaccattgggatatcgg

ttaaattgttggtctgttatatttggttaaattgttgggtttacattaaa

ttaatagatatttttgcatcattttaataattgtagttgttttttttttt

tacatttttattggatagcaaagttctagaaaagagaagtaatttaaaaa

ctatataaatagttcactgatatatttcttgatattttatttagcatatt

ttatcttaataagtttatattttaacacttcaaaaaccatttggactcat

tttgtcaccattcctattgctaatggtcatctgtattcaatgaaagaccg

aaaactgatgatttctgaacatgcttgtgtttttactcactctgaagCCT

GCAAAGCGCTATTGGGAAGAAACAGAAAACACAGAGCAAAACAAACCAAC

CGAAGAGGAGAGTAAAGATGAGCAGAAGCAGAAACCCCACACAGAGAAGA

GAAAGAAAGAAGAACGTTTACTGTCAGGGgtaaaagttttctctttgcta

cttaagctaaagttggttttatatttacacattcgttaatatttggatgg

tttgcaggccaaaagtttgtgaaagtcagtatttcagcagcacttctgat

tggttgtttagAAAGAAGACCCTTTTCCTGGAGAGAAGCCGATCCCACAG

AAGCAGCTGCGCACGTTTCAGAGAGGACAGAAACACAAAGTGgtgagtca

tgaatcgacatttaggactcgtcgccg