scavenger receptor class B, member 2

cDNA: Genbank AY099528

 

hi1463 and hi2715 are both in the 1st intron

 

aaagtggtttctcatgcgtgactgtctcaTTTAAATGTAGTGAGGGAGGA

AAAGACCTATGCTCCCTTTACGTTAGAGCTGATAGTCTCTTATCTGAGCA

TCCGAGAAATACTCCCGTTAATCGCACATCATTGCCGACGTCCTAATGAT

AGATAGAGGAAAACGATTCAAGCTGTGAGACTATCAGGAAAAAGGAAACA

TACTAGGACATTCTGTGGTAGAAGTTCTGAATTAGAGACAAAAAATTGTA

TTTTTTTTATTTTTATACAAACAGGCCAGTTTAAAACGATTAAAAATGAC

TAGAAGATCTTGTACTATTTACGCCACAGGGATTGTGTGCGCTCATTTGC

TAATTTTGGGAATCGCCCTTCTGCTGGCTCAAGTCTTCCAAACAATGATC

CAAGAACGGATAAAAAAGgtaagtcttttctggaaagaagtgtcaatgtt

aaacctgtttaatcatgtaacggtacaacgcttttgctttgcttttcaaa

tcgacttttaaggtggttcagt

hi1463 (5-3)

aatggtacggtagtgctgtctaaatgaggtgttctgtgtttaagctttaa

cattacgctgacactgctaacattgcgaaatcatatcacaagctaaatct

tgtcatttatctatcataagacgatccttgaaatagttctcttttttacc

agaaagacaagttgttcattcaaactgagacaccgactacacaatcatgt

tacgtacaggggacaccggctttttacgttagcagtttaatggccctttc

ttgccgtgcagatagtgaaaaatatatatggttat

hi2715 (3-5)

tacattaacatgatcaaatcacgggtttgttagtaaaccagactaaagtg

tgctggttgttttgtgtgaccgaagcccatcatattgcggaatatatata

tatattatgtgtatgagagagagcgtataaatatggcagggggatgtgtg

ctatgtgtgtttgtgggggagggtctcggtgtggtctgttctccttgggg

aaaaaatacttggaatttcgactcgtcgccgtcg