DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 19

cDNA: Genbank AY099536

 

hi1464 is in the 1st exon

 

caggaggaaccacgttctactgaacttgtttccgcacggaggtgtgagac

tcgcaacccataagaagcgaggaaagccgcacgccattGTATGAATTTCT

TGCTTTCAAGTCTGTTTAGTTTCATTTTATTAAGGATTTAAGTGCTGCTT

GATTTTgaAATCTACTGTTACACAGAATACAGTTTTTAAAAtAGGCGTTT

TACTTTAAAAAGAAGGACATGGCA

hi1464 (3-5)

ACAGATTCGTGGGCCCAGGCTGTCGATGAACAAGAAGCTGCAGCGGAATC

Ggtgagtttagcgaaaatacagcgcattaacgttactaaactaagttact