chromosome 6 open reading frame 194-like (FLJ22626-like)

cDNA: Genbank AY648738

 

hi2991 is in the 5' UTR

hi1477 is at the ATG

 

tcttcacactccatcacagtaggtggcgatatgcacctttaaagttggtt

cgcaactcgccataaaacgaagaagaagaagaagaagatgtcaccagggg

gcgctattgagcaggcttcgtgccaatgagatgtacgtcacattagaaga

atttagcgtagcggaaacataaacacaagcaggctaaagttCAGCGTTGC

TAGTGTGTATGTTTTGCGTTTAAGTTGTCTTTAGGTTTCACGGTGTGTCT

CAACACATTCATAATATTCCTA

hi2991 (5-3)

ACTAAGTATTTTGTCGCAGTGCTAAAAGTGATTTAAAACCGCTGTTTGCT

AACGTACATATCTAGCTGGATTAGCTTGGCTCGTTCTTGGTGAACTGCGA

CATGACTAGCAAAACGTAACCAATACGTCCCTTTTAACAGAACAAAATAA

GGGAATCAAAGACGTCGTTATAGTGTAGTAA

hi1477 (3-5)

TGCCTGAGCTAGACGTAAAGCATTCAGGCTCGGTGAGCCCGAGGAGACGC

AGACACAGCCGCTCCAGCAGCCGATCCCCGGACCGAGCACTGAAGAACCA

CAGACACAACCATGAAGACGAGCACAAATCACGACACGGCGACAAAGACC

GCAGCAGAAACCGCTTCCGAATGGCGTATTCCCGCAGTCGCTCGAGGTCA

AGGGAAAGGGACCGACAGACCTGGTCGGACAGAGATCACGGATTCTCCGA

TTACTATGAaAAAAGAGACGACGCTCAACGACAGAGACAAGAAGCCTTCA

TCGCGAGgtcagagagactctcattatactttt