40S ribosomal protein SA

cDNA: Genbank NM_201052

 

hi1479 is in the 1st intron, before the ATG

 

ccatagactcatttacactcatacacagaccattttagcttacctaattc

atctgcactgcgtgtctttggactgtgggaagactggagcacccagagga

aacgaacggcaacacggggagaacatagaaatgccatttaacccaaccga

ggctcgaactagcgaccttcttgctgtgagggtacatgttttgaacacaa

ctgccacgtatgaaattctccaccagcagatgtcagtattttaatatcga

attagaaatgagaaaagcaacgagtaaaaaatcccccaacagtcattggt

gaacacccgagtatataatgtacgtcatttcctcttcccgccCTCTTTTT

GCCGTGAGGTGCAGAACTCCATACGGCGTTGTCTCGTGgtgagcagaaat

tctataaatttgatgatttctagatgtgtacgtctatcagaccttttata

ataaaggttataataatctgttttcatcagatgatatgttaaatgcgaag

tttaaggcagttctcgtgaaatataacggcttaatccctgacttgtgatg

tcgcactaggaaacgcgtgttcggctgcagtcagagtagcgcgcgcggtg

gtcagacccaaaatttatgagcactattgttttgttttacgttgtctcta

tattgtataacgttagcgatattagttggtaataagtcatactcgcattt

attcagttaattaaagcgagaatgcgtaatattccaggtcatgttgacaa

ttttgaaacaaagtaaatagttaaagtttcgtttctagtaaagtaa

hi1479 (5-3)

tttccctaaaggtatcaggcgattcattacaagctaagaaaactggcaaa

ttctgctaatttatgttgctgttacagtatagttagtttttatattcgca

catttgttcatttaatagtccctatattatttaccaggtttatctggata

atattcggtctgaattaacatgtatgactgaaagcaacattagcactgtt

tgtttgactgtaaacgatgttgtactttgacagtctttggttgttaatat

tatttcatacttaagacatcgcaaataatatttttttaaattatattaag

gagaaagtctaactgaatattaaactaacttttaccacgatgttgctttg

tgtaacg

 

approx 1.3 kb to first coding exon