tryptophan rich basic protein (pinball wizard)

cDNA: Genbank AY648739

 

hi1482 is in the 1st intron

 

atgtttgtacttactttgctccttttaggcatggctgcttaaagcgtgtg

tgcttttagaacaaaaataggaaataaattacagcagcttcagcaccgat

tagtaaagagtaaaaaacaggtctgagaaacactgaagcaagcttaaatg

ttctatcggaacggaaactagctgaaaccggattggatctcccctttcta

tattcttttcattatagcactaacctgatgcaggctacgctccgcccctt

ctgagcggcgattggctgaaacgtcctggcaaccgcatttcaaaccaaag

caaagtacctgtttggataggttgaggtgccaatcacagatttgcttgat

attctttaggcgccactcttaataatttttgtgtagcgtacgcttataaa

tgtaacatttaacagcggaagtgttgagtacacattcaagcattgcaaac

gatttaaatgcatttaaagatattcgctgctgacgcgaaaacaatacttt

ttatcgtacaaacatgggggtttaaaacacatttgaatgcaattgcatgt

ttttaaacaacacaagtgaacaataaccgtctaatccaagggaccacttt

aaaacagggctatagtccgtttgaataattgggggaggatcaggctGATG

AAAAGAAAATGGCTGCCGGGTTTAACTGGTTTCTTGTACTGAGCTCTGTG

TTTTTGTGCAACCTCGTCAAAACATTCCTGCCATCCATTTCTTCATTTgt

aagtactcaattaaaacgagttttagggacgcttaagcacatatatattt

tatttaaaacgtg

hi1482 (5-3)

tttttgttgtaacataacgtgacgccacaatgcacagtgatacagcatgt

ctgctacccctaccggagcttcttgtaggcacagcgaacaaaagcttcga

ctcgtcgccgtcg

 

aprrox 2.4 kb to next exon