membrane-bound transcription factor protease, site 1

cDNA: Genbank NM_199213

 

hi1487 is in the 1st intron, before the ATG

 

cccgattgactgattaaatgactcatatagtcactgttttaatttgtagt

catggcgtatttctattaaatgtatgttagtgtcagctagtgtatgtcag

tgtatgttagtactagtataatctattggaaattaataagtactatgtga

taaaaaactagtagtatctttataataaagaatatgttgcaatttatatg

tgtaattaaaattacagtagctatatctgctttatgactatattctttag

ctcatatgtatatgctttcagtgatattttaagtaccatacatatagaac

gtttttaatgcaaaacaattattacataattgcattgcaaaaacaatgtt

tacataaattgacaacataaaacaaatcaagccgaaccagtgcaccttta

actgtgcttctgagtcttgacatgaagccttgtaccataggaattgttct

aaccaatcacgtggaggcataaaagtaaaaacgttttctattggctgtac

gcctatccctccctagtcgagacatgacgtaacgatcgataattggcttc

tgcttGTTGTGTTTAATACCAGTTTCTCACATTACAGTCTTACAGCTTAC

GCCATTAGCTTGGGAATAGTTCTAATATGTATTAAGACAAAGATACATAC

AGATCTCAGACGACATATTACTGGAATAATCATTTCCTGCACCGTCGTTG

TACATTCCGCAGATAgtaagtagaatatgggattgggat

hi1487 (5-3)

gatgttgggatatactcatgctttgctaagctaacgttagcttgtagcag

gatgttgacgaggccacatgtttgccttatttggtgataaaaatatacat

atttaaagcttttctgtatacgagaaggtcgttaataattagctttgttg

caaacgcagcgtaaacgtttgttttgtgctgtcatgttagctagactgct

aacttactgttattctcattagtttgtatgtggtgtattctcttaaataa

aacaacaaactgtttcatgtactgatgactgcaaaaacaaaacagtccat

tcaaatagattcgttcaaatagaataagttcttccaaatttgcatctaac

atagaaatgctgtccgtgtcaatacaaaggctttgttcagtgctgggaga

cgtcaacaagaatatataaataagaata

 

approx 5.7 kb to first coding exon