xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7

cDNA: Genbank AY648740

 

hi1516 is in the 5' UTR

hi4063a is in the 4th intron

 

gtcgccacaacggaatgaaccgcctgttttacatagatcatttgatataa

tgtgaaatcgtttcggctggtctgaaaggtttatagaggttgcaacaact

gcgacaacactcacttaaaaaaagataacgtaatgaacattacttttgaa

gtgtctaacacattgttaatgtactcgttcattgctgacaaatattaaca

aaatcactttttaagcaggtaattagaacgaattatacaacttaaccgac

ttagggcaaagatttaagcttgcccttgcaactatttgttagtcgtattt

ctaaatgtgttactgaactcagatttctcttccccatttctttctttttt

agtttgtacgttacatataactaataaatttgatctcggaatatggtgta

acaccgctgaggtcagagagtcctaggaacttaactcctcacaatgtttc

cagaggaatatttcaaCGAGGGACGCTTTTAGCCAGCGTGTGATTTTTTT

CTTTTGTCACAGTTCTCTGTCAAGTTGTTATATATTTATCGGCAATGACG

CGTCGTAATAAATACACAGA

hi1516 (3-5)

CACTATATACTATATCTGGGCCTTTTAACACACGTTTAATCGGTCATTCT

CGTGGACGCGTTTTCCTAAAATCAGCTCTTGCCGTCTGCTTGTTATTTGT

CGTACCGTTATGAGTGACGTGTAACTTAACGCGAAATTCTTCACAAATAA

CAGATCTGAAACAGGTTTATAATGCGCTTAAGCGTGTTAAAGTGGTTGTG

TCTACTATGAAAGAACACATTCAAGCCGTCCGCTGAGGATGTGATAAATT

GCAGCTCGTTTATGATGGAAAGAGACAAAAGACAGTGTCATAAACAGGAA

TTGGATTTTAACATGTAACGGTAGATGACTGAGGCTGAATATCACTGAGG

ATATTTGGATCAGCTTGCTTTTCTTCAGCGTGGTACGGTGTTGCTCAGAA

AGGCACAAAGATGATGTACTCTTCACGGAGGAAACCTGTGCTGTATTTCA

AAGATGACAGAAGgtaaagaaggtgctcactttaatctgaatatgatttc

aaaatgaacttcactttataatgaatttacactccattagctgaaatgta

aatggttgcatgtgggtgtgaacataaaaaataatcttaattttaatagt

ttaattttattacaattgttagattagtttgtgtgtgtttaatatgtatt

ttattctaatgtttttaaatataattttaagaagtgaaagtcaaggggtg

cggcgtccaggagagtgagtataaggcattatgttgttgagagaagtgtg

aagtttaagaaagagcagttgtgtacagatgcatgagctgcttgaggaat

aacaacacctttatgaaaagaatatatctaacgcgtgctgttgtggattg

tagtttgtgtatgctcattcattgactaactcactgacagtttacaccca

gagactcctgaaccatgcaaggtcttatgtgaactttaaagaccctataa

cattatagatgtatggtagcttctggtttctctttagttaaaactaatca

gaatattatttacccattgtgtactctgtatgcttgctgaaatgctgttt

ttaatgagaatggccttttcactaaaattgtcccaaaaatatacttcagt

tctatgcatgcatgagattgtgcaaaaatgagtgaattttgtcattcagc

tattatgtgtgtgtagtgttcaaatcctgcacaattttttatgtatgtat

acacagtgcacacatgctttaaattgagtctttttgctacttccgttcat

ccataggatggttcatccagaccagtgttacatgatagaaaaaggagaca

aaaccagaaaaaaaagcaaaaacacagaagtctactttggtcttgtatct

gcag

 

much later in gene

 

agatctatcatacactaacatttaaaaatcatatctaattattgttttca

gttgtttgtgttttttaattttttaaaaatgttttccccatgaaaatagc

tcttgttgctgacatggcactaaataaatatacttgctatgataccagtt

gtttattggaagcacacattatgattttgttttctaactcttgtctcagG

TTCAATCGTGCCTCTCTTATTAACGTTGGCTTCATGGAAAGTGGGAATGA

CACAGACTACATTGCAATGCATGATGTGGACTTGTTGCCTCAAAACGAGG

ATCTGAACTATGGGTTTCCAGTAGACGGGCCCTTCCACGTGGCCTCACCA

GAGCTTCATCCTTTATATCACTATAAGACGTATGTTGGAGGAATCCTGCT

GCTCACTAAGAAACATTATCTGGCGgtaagaaacccaaagtctttggaac

attctgggattttccgaatttgtttgtaaattacaattgcttgtgatttc

tgcctaaagTGCAACGGGATGTCAAACCGCTTTTGGGGATGGGGAAGAGA

AGATGACGAGTTTTTCAGGAGACTGAAAGCAGCTAATCTTGAGgtacatg

hi4063a (3-5)

atataatctaatctaatcctatataatataatataatataatataatata

atataatataatataatataatataatataataaacaattgtcaatgtat

atttgcagCTTTTTAGACCAACAGGTATTACTACAGGAACTAAAACATTT

AGACACATCCATGATCCAGCCTGGAGAAAAAGAGACCAGAAGCGGATCGC

TGCACAAAAACAGgtaatattcatta