mediator of RNA polymerase II transcription, subunit 19 homolog

cDNA: Genbank NM_001003416

 

hi1518 is in the 1st exon

hi1642 is in the 1st intron

 

agatctagctgtatttatatgtatggtaagctaaatagcgacccccaaat

tctgtcacccatcatatgtggccactgcccacagagcccagttcccatgt

taaaagcaggttatctgcaactgttatcatgttgaaaccccagatgtgtc

tgctttatacatacccaatcaaaatcacacgagttgccatcctcgcgctg

cgttgaaagatgttcacagactccgggcattttgcggatcatcacgaacg

cgatagacataaataacgacgcgatgtagtacggttttagtagccatttg

taaacctgcggcaaatgatacagaaacgcgaacagaggtgttaacaatgc

catgttggttttacttttatcagaaaacaagtgctgttgtggtccaaaac

ggcagagtccgcatcaacgccgcttccagtgcgtgataatattcgtcggc

gaatgaattaaccgatttaaagggacagaggtcacagcggacgaagaaaa

aatcgccccgcctctttaaagcgcggccgttgattggtcacttcacccaa

atggcgtctcttattggttttgtgatgtcacataaagggaagggcaagag

aaagtgtgttgtttaccgtagtgaacacacacaacgcgatgattttaaca

tgcgtcacatacgcaaacattaattgtttgttttgtcgtgtatgattatt

tatacaattaaatagcagttttaaataataacctgcattgtgacaccacc

atatacaagtctgttatgtaaaatgttggaaatctacacagtgtgagcat

gtactgcatcaattacggtaactttcccgaaggtaaacgaacaaccggaa

gcaattgtcaacAGACAGAACGTTACGGACGTTAAGTAATTGTCAACCGA

ATACAAACGTCCATACAATTAAACCGTCGCAGGCTCGCAGCGTAGTTTTT

GTCATCATGACAGAAATCTTCTCCTCGTTGTATGGCCAGCCTGATTCACA

GGGCCCCGCAGGACCGTCCGCGCTGGGCTTTGGCTCTGGGAAACCTCAGG

TCCCCCAAAACATGGGCCCGATGTGTTTCCCGCATCAGATGATGGAAGAA

GGGGCTCCGGTCAGAAAACCGGCTGCGAT

hi1518 (3น-5น)

GAACGAGCCCTTCTACCTGCTGAGAGAACTGCCCAgtgagaccagctttt

ctgttgatttctccataataatataaaataaaacagcatatcggtgtaat

tttacaagactctggattatgctattgcaatagcaggatagtattcagcc

tacagaacaccgatatatcacgtccaaatagctattgctatactgtagta

tgatcatgtattggtattggcagtactttgttaggtaagaacattgctag

tacatgtattgtaaaataaagtagtacaaaagttagcacctgagggaatt

tacataatttatatcaaatacataatttaaggttttgtta

hi1642 (5น-3น)

tagtaacaataattatcatatctacctcagtagatcttaacccagggtcc

aattatttacttttgtgaagtctacaaaaaatactacaattttctctttt

ttaaagcaactaagggtaaacgagaacattcaaaaaccctcagtagccat

tgagggtagaaaagtcaaggtattaatatcgctaaaattatctgttatac

cattcccaaggtttgtttaaatctcagtttttgaaactaacaaagacagc

aaaagtcaatgatttatttaaactattttgcctgacatgtttactgttcc

aaaaataacgtatgtttcttaaaataaaa

 

approx 1 kb to next exon