clathrin interactor 1 (enthoprotin)

cDNA: Genbank AY648742

 

hi1520 and hi2558 are both in the 1st intron

 

aaattctaatttttttttgtgtgccccccaagatttggtgcggcctcttc

tggccacccctaagaaaattttctgggggcgccactgcagaacgaagaat

tgacatcaatttcttcaatgaatctggttaaaaaatgcttaacagggtaa

agtttatgtagtatcttaagtaagatttctttgattttctttgaaattat

atatttaatagatacccagagtttccttcaattaatattccttctctacc

attttctgcaaggttactttaaagtatattatgtcatatcctcatcttga

aaggatgtagtgtttctgctgaagcagcctacgaaatttccgtaagtgac

ggagcatttccgtagaaacctgtgtggcctgcgctcctccgccgtaactt

tagagttcatGCTTCGGCTTTCGTGACAGCTCTACTGGCACGACCAGCGG

ATTTCAAGGGCTGGAACACCTGTTTACTCGACCGAGAGCCACAGCGACAC

GGCCAAGATGTTGAATATGTGGAAAGTGCGGGAGCTGGTTGATAAAGCgt

gagtattttggatgtttccgaaagtatttcggcgtcttgcctcgtacctg

ttgaaaatgaaacacgtacgcactcattgacgtcacatcggacatcgaga

ctggagctaagttagcacagcggctaacaacagctttgtgttccccttaa

aagtcttgtatttcaccagtgcagatttttcaatcggttttgttacttta

caagaggtctaaacttgtttattaacgccctaatattgcacagggatcct

taatatcaacacattggctaattttatgacacttgctaaacttgtgctgg

ctgtcaaaacacggcgcttgtgtatcaaagtgcttt

hi2558 (3-5)

ccacataaactaaccttgcgattgtttatctttttaagtgagaaaactgt

tgtttaaaacaggagt

hi1520 (3-5)

atgcgtttaaatttatatatgaagtgacttaaactttttgtaacgttcgg

gagtcatttgttcaagctaactagttagcctaatatgaacaacagctcat

tgttcatatttgtgtgctgtgtgtttactgccgattattcaacaaactgt

ttacatttttcaaagccatggatgtgtcggtgattatacagtaatagagg

ccctgagtttcatgaaaactgcagcagttaaacagaaacttgtgttttta

cccctaaaacgagagggacatcaaacacttcagaaatatagtttctgtta

tgctttagtacaaaccaaactaatacacatttgttcagaagaagaaaatg

tatctccaatgaaaataacattttaaacaaacataaacaacattatactc

aaaggtcaaagaaatgttttacatgaattggtttatatttagtattttga

actaaatttcagctgggacccacttttaacatgtttccaaaccatttaaa

tcttgcatgaggtgtaagttcctataaaattaacatggtattgtgacatt

tttctatctgaatttgaataaagggcattgttttattaaagtattccttc

tcacaaacttttgtgcacagcaaactaacagttgtagagaaatggcttat

ggtgttttacttgagctgtctaacagccttcagaaggatagacattcaag

agtggaaacaaatttgattaaagattaccaaaatttcttgcaaagagtaa

tcattcacctcaagaagagcaatgtgagccattaaaatctatttattttg

gtttgttgcagactttaagagttttgtttttagctgtgctatctaaaatc

aaactgtcagttactgtttaatgaataatttacgagtttgtttattatga

aaggattgcaatttagaattaaatgtgccagtcagagataactcaaatct

gtagctggtcaccccttattaaacagaaactttgtgacataaatatcatt

ttaattttagaaagtttaatcattttaattaaaaaaatagaataaaatga

tctgttttatggtgatcattaattattgtgcaactctcaatctagttttc

cccccattcttatcttgctattttctcatagtacagaacagcggttgttg

aaggctttaattcacaaatgagagtttgtgcaaacttttgggtgttacct

atctgggtatgtctctgaaactgtgtcatttacatgaaactatgtgatga

tttacagctgacatggcagcatatgctgttggaagataagtggtcaag

 

approx 3.1 kb to next exon