WD repeat domain 1

cDNA: Genbank BC045455

 

hi1532a is in the 2nd intron

 

ctgcagaatcgcgggattgtagtttattatgtttagt

hi1532a (3-5)

gagtgtttccgcggagtaaagcgtgtcgtgttttagttcgagtgttatta

ttaggattgtgtgtgtgtgtgtgtatgtgtgatttatgtgagtaggatag

tgtgagagcatcaggaacagtctgacagtggatcagcctatggggtgtga

taaggggcgggactttgtttgtcattggccaatgggcgggcagggtgtgg

agacggttatgttggctgtggggcgggatgtaatgaacattattattaat

ataataattcagattttctcattaataaaacagtaaagcgctattattat

ataacaaagagcattgagagtgtttctatatgtctatgattgtctagggc

tggataaagacctgtaatcttgtgtttcctccgcctcaggttcttcagtg

cctcctgcatgcagtgacctgttcatattccagatttatttatagttata

ttttcacactactgtaccacatacacaggggttcagcaccagctgctagt

gaaataatattttagacccctaataataataataattataataataataa

taatataaattttcctcttgcttgggcacattggataatttgccatctta

gcacagtaattctctaaaggatatgactaattaactcaattaaacatttg

ctttatggaattactgtgccaagactatctaacataaaaatatacctcca

tttccggtagatgctcctccagcataccactctcaatcagcctagcataa

agacatgtattttaaactttaattagaaagaaactttaatttaatacgag

tttaacaacggcttcttgttataatgattggttagatattcctgtaagct

cggctaatttcttgcacaactgatttattcctgaagctgaattctgtcat

attttggggagataaaaatgatccaaaattatttgagagatcacgtaacc

atgccgcacggtggctcagtggtgttgcactgtatcctcacaacaagaaa

gtctctggtttgagtctcggctgggtcagttggtgtttctgtgtggagtt

ggcatgttctccccgtgtcacatccgctgtgtaaaaaatatgctggaata

gttagcggttcattccgctgtggtgacccctaatgaataaagggattaag

ctgaaggagaatgactgaatgaactcgcgtgacctgccggtgttcatagc

tccgtctgtcgtcagcctgattgaccgctgtacgctggataaatatactc

gtgtctagtagatgttggtgttcatattcttccagtgtgtccatgagcac

ccctgctggcaggaagtggagttgcactttcattcaggctgtctgcagtt

tttcttctcacacaagacaaagtttgtgtgtgtgtgtgtgtgtgtgtgtg

tgtgtgttgtgcagttcatcgttagctgatgttgtgtgtgtctccgcagA

GCGAGTGTTCGCCAGCCTGCCTCATATGGAGAGGGGCGTGGCCAAAGTCC

TGGGCGGAGACCCGAAAGGAAACAACTTCCTGTACACCAACGGCAAGAGT

GTGATCATCAGGAACATCGAGgtgaaactttctgtttggaaatgcgaatg

atgaaatcttgcttctgttgcgctctctgtgcgggagataatcatgttaa

tatgttaataatgttaataaactccgcgtcgatgctgatatacaagaata

cgatatctgatgacattgaccatgcatgatgttattattgtggggaaaat

acagtcaatgattatttaatgttctacagtgcacataatgttgttttcat

cacagcctcacattaagattgaagaattgaagagtgaatgggctgttaat

tattaatgaacatttagctgttaatctgatactctctgacacgctgacat

actgactgaatattgattagagactgcgaactcaatcaatattggagact

gagtaatcaataattactcttagctgatgttcatttctctatggtgaatc

tgtttaattaaagctgcttcagtattgtgagactcgagtgttcagcctgt

ttctgctggctttgatcagttgctgaatgttctgatcgacgggctcttca

gtgtctttctgttgttatttttaagagcatgaaggaacacacactctgta

ctccagcatgactttaccatgtgtccagtgtgctgctttcagtccagcgg

ttattaccattgtagtttactgtgtgtgtgtgtgtgtgtgtgtgtgtgtg

tgtttgtctgtgtgtgtgtgtgtctgcagAACCCTGCGATCGCTGACGTC

TACACCGAGCATCCCCATCAGGTCATCGTGGCCAAATACTGTCCCAGTGG

CTTCTACATCGCATCGGGCGgtgagtgagtgtgagtgcgt