FLJ12716-like (foie gras)

cDNA: Genbank AY648743

 

hi1532b is in the 12th intron

 

ctgtgctgatgaagtgaatctgaagtgaatggctgtacttcattacacac

gtgca

hi (3-5)

cacgttttaaaacatggtaaacttgtaaaactcactcttgatcacgtccg

atgatgattgatgatcctagcaaactgaacagaccttttattcccggttg

ctttgcgctcgttctgtcttgtcgatatgattttatgcattactatggag

acatgttaatgcacgcagctgtcaaccaatattggagggtggggggaccg

cactcctacgtcaagttgcggtcgatctgaaaaccgccccaattggtcca

ccgtttttatgttgttaaacttgaaaaaaaggactgggtgtgtttatttt

accccaatatgacagtaaatacactatactaacacacatgtatgtccaaa

cagcttgaaaagtcgatttttcaccataggtgccctttaagctgccatta

ccaaaaaaaatattaagtccatttcagtagttcagtactttctccttatc

tcattccattgttattacacatttttcagttttttttttttttttaagtt

ttttatgtttgtattgtttggggtttttaacaaaatctggttcaattcca

tgtcaacagctcctttagaaatattattgccaggaaaaaagcatccctgt

tcaatacttatttcccccactgtacatgcattataagatgagccatatta

tttagtgctcaggttgtacgaaattaacgaatgaaaaaaataataataaa

ttcccttttttttaaaaatatttaaacattttttcctttcaattattgta

ttgctgtaattacttcttttattatacattgattgtttttgattaattgg

ttttaattacctttaatttacaagttagtaatctaatttggaaaaaaatg

tcagtgtaattcagcgtccatatatgtgtggatgtacaaattataacatt

taatagtaaaaaaaaataaattaaaaaaattacattaaaaattaaataaa

aaaagaacttttgtgtttgtttatttgggctgggattttaatttgtaaat

ttgaatttagattttgtttcaggatttatcgtgcaaatattcaggccaaa

aaatcagacttcagaattttcaaatagctggtcctgagggccttgtttat

gaacaaaacacatagacagcatatgactttttccagcttaaattcaacca

tttttttcctcctaactgttattaaatctgtgctcatttcagGAACTGAT

CATTGCTCTCCTCAGCAACGCTGTGGCACAGTTTAAGAAGTACAAATGTC

CACGAATGAAGAGCCATCTCAgtaagtccaaaaacacacatttatttcag

ttatttaatttcagcaatgtgaaaactttgctctctttacacagTGGTTC

AGATGGGAGAGGAGTATTACCATGCAAAAGACTACACCAAAGCATTAAAg

tgagttaaaatcaatatattgttagtttggcatttctaatatgagtttat

acctgtccagtactcacagttgtttttttatgactcccagGCTGTTGGAT

TATGTGATGTGCGATTACCGTACGGAGCGCTGGTGGTCTCTGCTGACGTC

TATCGTGTGCACGGCTCTAAAGTGCTCATACCTCATGGGGCAAGTCAAAG

ACTACATCACCTACTCCATGGAGCTTGTGGGCAGAGgtgcgtgaactcct

catattgactattagctttagtttaatcagtaattactgtgcttgctaaa

atgtgtgtgtttgtgtgtgtgtttagCCTCTATTCTTTCTGAAGAGCAGA

AATCCAGGATTGAGAAGAATCTGATTAAAGTGCTCATGgtacgtgtgaaa

attttgtatacttgaaaatatta