CWF19-like 2, cell cycle control

cDNA: Genbank DQ181569

 

hi1537 is in the 1st intron

 

cgacggcgacgagtcgactagtcgactcgtccaacaagtattttttaaac

gctgaattacggcaaacacttacgacagtagaggttgtgtttgcggcagc

gtcATGGCGGCGTACGGTGTGAATTTTGAGAGCGCAAACAGCATTAAATC

AAGAAAAGAGTCCAAAAGAGAAGAAAGAGAGCGAGTTATACAGAAGgtaa

cgcatacttactaacacgttaaactgttatggagtcagaatttaagtttg

cacaagaggaaattgatcttgttctttatatgtgctattacaaaataaac

attccgctttaatatatataccgtctttaaatatgctgtctcattccgag

tttgtctgtttttaggctagtatttgagattttcagtgtgttttaagtgc

tataaatgatgtttcagtcttgatctcataacatctgaagtcatttgtct

aatatttatgtttattttgttgtatttacttgtaacgttatgacataact

gttatcagcattttaatggtgactgaagttgatcaaatatttaatatctc

atatcctttaaggaaatatataatataaataatatttgtttaaatgtgta

aaccataccgagaacaacaaataggattttaaataatagtaatag

hi1537 (3-5)

atttgtttttccgaaagcttaaatggtaatatgtgattgcattcaaaaat

atacttttaaaaggctattcgtttactatgctcgtcaaattcgtaaatga

tttacggatacgacatcatattattatgtttatgtacatggaaagcataa

taattgcaaataaaaacgccacaaattcga

 

approx 5.3 kb to next exon