integrator complex subunit 7 (DKFZP434B168-like)

cDNA: Genbank AY099529

 

hi1548 is in the 5' UTR

hi3649 is in the 1st intron

 

gtcacacttcAAACTTAATGCACAAAATCCCCATCTGATAAAACAAATAA

AGTGTTAAATCCGAGAGCAGTCTGTCGGGTTACATTTTTCGCAGTCTAA

hi1548 (3-5)

TAATAAACAATGTCGCTTTCAGCAGCGCGTTCGTTTCTTTCGGAGGCGGC

ATACGGCGAGCAGGAGCTGGACGCCAATTCAGCGCTGATGGAGCTCGATA

AAGgtggctctttataaacaacacacgtgtatttgttttttgatgcagtg

tgtgtgtgtgtgctattttaatgttgaatatcatacattgtatctgttcg

cattaaaaagctcttctataattttattatgtaggctactactgtacttt

agtctatactgtgctttgttttcatttttacag

hi3649 (3-5)

aatgttttagggatgtaacatatgttatggaaagatccagaatttacgca

accgtcaagtagtttgacttttatgagtttcttcttctttgcacacgcca

cacgggtgataaaatgctttaattttaaactactaaggtctaaaaagtgc

ttagattatggatgaagtgcttggaaagtaattgcattgctttcataatc

attgatcttactgaacgtacaacattgtttacagtcaaaaaattgtgctt

atgttgttttgaagtcacacttacatgtgattttatactgaatattcaaa

gtaccatggtaaacgctatagggagcgtgtcacaagttgtcaatgaacaa

atgtacgaatataaccccaactttacctgtcttattaaacgggtaataac

agtgaaaattactgtttaaataaaagtataataactctcattgcttgtgc

ataaaatgaaaatctggggtctgtacataagcctgtagcatgatctgcct

tctatcttattttgtctgcactccttgagtataagatgaaattagataca

tctaagatttaagtaaatgacattcatataaaaaaaaatcttatgaatag

aatctgataaaatgtaataaagcatgtgtgtgtatgtaaatgtgtaatat

gccacacatttacatactcctgccttcaaaaaatgtgcatctgaaaagtg

cttaaattatataaaaaagcatgcttcaaacacaaaagaagatactttga

acaatgttcaaaatcagtaacctttgacttccacagtaggacaacaaatg

taggtcaatagttacaggtttccagcttttttcaaaatattcaattcaat

tcaattcagctttatttgtatagcgcttttacaatgtacattgtgtcaaa

gcagcttcacataaatggtcatagtaactggaacagtgtggttcaggttt

taaaatatcttctttagtgttcgacagagtaataaaactgaaatgggttt

agaaaacaaacaaaggatgtgacactaaaaaagcaatacagttgaagtca

gcattaatagcccccatttgaattgttatttttttttttccagaatagtg

tttaacagagcaagaaaactttcacagtatgtctgataatatattttttt

ctttttgagaaagtcttatttgttttatttcagtaagaataaaagcagtt

tttatatttttaagaaacattttaaggtaaaaattactaggccctttaag

ctatatatttttccgatagtctacaaaacaaaccatcgttatagagtaac

ttgacaaatgtatgctgtttgttcatttatttaaaattaacagaaacaac

acaattgttaagttttattttgggaacacttagttgttttagattcaatc

aactaaaatttgtaaaatctaataatataacttaatccattcatgctatt

gtggaacccaacatttttacagagtatgaataaaaaacatacatatttga

gcgtgaatcattccttttactcacacacttctgattttgtctttgctcca

gGTTTACGGTCTTGTAAACTGGGCGAGCAGTGTGAAGCCGTGGTCCTTTT

TCCCAAACTCTTCCAGAAATACCCGTTCCCCATCCTCATCAACTCTGCCT

TCCTGAAGCTGGCAGATATCTTCAGACTTGGgtaattgcacatataaata

catacgaattatgtcaggtaccgagctgaa