myb binding protein (P160) 1a

cDNA: Genbank AY648744

 

hi1552 is in the 1st intron

 

atgtgtgttgtctttggactgtgggggaaacaggagcaaccgaaggaaac

ccacacgaacacagtgggaacatgtaaactccacacagaaaagctaactg

acccagccgaggctgattcagtgaatggtcgggacttttattttgaattc

aatgcacggaagtaaacccggaaaaagacgtctccgcgacctccccacgT

GTGCTCCTCTCGCATGCTTCATCTCTGATGGTTGCAGTAATGCAGACAGA

CATGGGAGAGACCGAAAACTCCGCTGTCCGACCCAAAGTCACCGATGCCA

AAGGCATCCTGAAGCAAAACAGACAGTTCCTGGATTACTTCTGGGACATC

GCGAAACCCGAGAGACAAATCCGACTCAAAGCCATAGAAGACCTGATTAA

TTACCTCAAGAACAGCGAGCAGgtatgaactggcacttctgaacatttaa

actgtgtctgaaaagtcttttctgtttattactcttcattacttactcgg

agatctgcatattactgcagttaatgctgtaatttcaatcaaagcagtaa

gctcagttcctaatgtaaacacgtgggttctgggctgttgagggcagttg

tggaaacgtgtctatccacatgatgatttgttaaaggat

hi1552 (3-5)

aaaaaaaatatttattattatatggtaggtttagtataattaactataag

taaatataaaaaacaatgaatatagtaactattaaattgaggtaaaagtt

gctctatatacgcacatttctaaacagtgacaacttgtggcatgttctct

atattgtttaccatcctactttaaatctttggtctgaaatggcatgtggg

catgacttcaaaacattagcattacataattgactgtaaacactgttgtt

ctttgataatcattggctgctaataggatttcactgtgtataatttgcac

aaaatacttttctgaacttattttatcatggagaaagaccgaatgtgcga

ttacagaaccaactttacctcaatatcaaatgaaacatcttattttatgc

acagtgtcagtgatgtgtgactataacgttagttggctaaacagtagctg

ctcatttttttaaacaaagtgacaactggttgtttacctcggtacctgga

ataattggtctgaaatcgcatgtaacaacaaaacaaatagagctaaagtt

ggttttatattcgcacattcgttcatttagaagtctctatactgtttacc

attttactttgaatattcgattggaattagcatgccagtatgacttgaaa

tcaacattaacactgtttatttgaccgtgagcaatgttgtactttgatag

tcatttgctgctaatatgatttcgctatttagattttgcaaataatactt

ttatgaaattatattattaaggggaagtctgaatctgcgaatataaaacc

aactttacctcaatcaaaacaacattagctctatttaattgactgtgagc

aaacttgtactttgatagtctttggctgctaatacaatttccctgtttag

aattcacacataaagatggtgtttgtaagtttttgactcttctaaagtat

aaaaataccataatatgtttgcagatatttaaaaaacatgctaagtgaac

atacttgtttatctgaaaaagaatcctgaagtcagatattctgctttgaa

aatgtgtgttacgtgccataacgtctgtctttgttttggttcttttaact

tgcccgatgccagtttagccaattatacttcagcaccccgggttgccttg

gtggaaaacagcgtatttcattcattcattcaggaaggccctcaaagtgt

gaatccatgaccgaagtacagcctctattggacagtagcagactccgaaa

tgagatacagagttccacatgaggttattaaataacaaatgatagaaaca

ttatgaatgtaaacattaggttagcaggttacattgtaaccctgtgtctt

aacaactagggttgtgccgataaacaataccattgtccatcgccgatggc

caacaaactttacgatgctaagccagcatcgcgatccatcaccccgcccc

acatttatattgatatataacctataatttgcatgtcatcttaatagcaa

taacattcttttcatgagctgtgttaaattgtacatatagctgccgcttg

cacggctgacagcatcatgaggattagatgaaggataatacagtacctct

tgcacttaaaatgtgtagattcagtggcaaacactgttacctgcaaaccc

cgtcctacagactttacagtgaatggctttagtcattttcatagcggact

tgaagccactggaagtcttttatccactcttggaaaagtgtaaatagtgg

attaacatttagcacatgatcactaataaaatgtgccattattagtaact

gtaggtggtttttaaaacaaaaatctgtcagtgttattttcattctctca

tcttcagcgctttacattttcgcggttgtagctcctgtcatctgaaggca

gaaggcattgactgagtgattgacaggtgatatcaaccaatcattcacat

tcagttagagcagtgggccaataagaagagcacaaaggcagggcaagcat

tgcaggctttttacttaaagggcaatgaaacccccttgtttcagcagggt

gttttcacacctctactttggaaaaagtcagaaaagtggatgtgtccagc

tctgtttaggggggagtgtcagaggaaataaagagggatggtgtgggagt

gtctatttgggcacgtgctgagtttcagtatcaaaacacacacacacagg

agaaagtgactgtgtttacatggatatctgtagtcgaattatttgccaaa

tcaataaatggtggactttaactgcag

 

approx 2.6 kb to 2nd exon