RIKEN cDNA 5730590G19-like

cDNA: Genbank AY648745 (5 UTR not defined)

 

hi1573 is upstream of the gene (or possibly in the 5' UTR)

hi3202a is in the coding region of the 1st exon

 

tcgacggcgacgagtcgactagaacaaaggaaaccactgtgtggactgtg

attttgctttgactaatactattgtacttatggctcatttataggagata

cagcagtggttctcaaactgtggtacgtgtacaaccacgcggtacgcagg

cttccctctacaggtacacggaggattcgctgaataaataaagttaaaaa

aataaaaacacttttaaccttttgatgcgaacaataagcccgatgtgatc

agtaaaagcctgattttaatagggtaacccttttatttgattttcaattt

tttaacgtttgttatgtattctatcatgggaagctaatctccgccccata

tatgtaatggttgatagggcgtatcctctatttttatgtcccaatgttga

caggtatagattaatcacttgcttttctgacacacacagcctactctaac

gcatattaagcagatcttatttctaaaaattctttaaatatgtaaattaa

attaatatatttaaaatacaagttaatgtttatatttcaaagatataaaa

aagtacatgcatcatatattttaaaatttatcaaagagtttatatatgaa

tatgatgacatatagcctattatgaggtccaaagtacatttccatgtttt

gatgaataagtgactttatgataatactttacatttaagtacagcagttt

tctttttacttttaagaacagtgtcattttaattaattttcaaaatcata

ttttaatttaaacgttaacattaaattttttttacctgtgagcacagtac

ggtgttaatgttcaaactatttataatgtttaaagtggctgacaataaat

attcataacaataagaattaatctggcacgtttttgaactgtgcagagct

ggagctggagctgcacatacttagcttaattaggcctaccacgctactgt

atttcaatactggtcattatgatggtacatggagcgaaaaaaaattctga

ggtggtacttgatgaaaaaagttcgagaatttgagaattcatttgtaaat

agacaacagattgttcagacgctcacatttttaagctttacataaataaa

ctgtttcaaagttgtccctttgacttcgactgctgtccagtagatgccag

taatacattaacaatgcactgcgttctacacaggagaagaagctcttttt

attgatgtgtctgtggaccaatcacagagcgagacgctattgacgtcttt

gtatttttatgttgcttgaactccctggtccaatcagacgaaaagaaatg

aatgacgtttttaaagttcatgcgctccagccaatcgcataccgcgaatt

ctgaagcgcgaagagttcaaggcaagcgcagtggacgatggctaacggaa

aaccctgaagtgtgataaacaacttttaaaaatgctatttttacatatat

tccgttacttttaaccgtatatataatcagtggttcattttaaactgttt

cgggttgttttatctcaacagcgacaag

hi1573 (5-3)

tatcatgactcgtgttgagaacgataacgtccgtgtgcgttcgctggcac

cagctgcttgtgagatgtagcttgcttaacgttagcgttcaatgacattt

taaataaggtgacgtcactctgtggggcagttttttatttttagaagtat

aaagttgtgacttttcgtcgctggagactgtattattgtgcatgggagct

ctttaaacacagttATGGCCTCTCAGAATGTCGTTTTTGCTATCGACGTG

GATTATCGACCCGAAGGGACCCAAAACACGACTAATGCCTATCAAGACCA

CCTCAAACAATGGATACTAAGAGTCCTGCTCAGTTTGG

hi3202a (5-5 tail-tail tandem insert)

GACACAGATATGGTCTGGAAAAAGTTCGATGGGGGTATAAATTCTTCAAT

TCGAGGACTGTGAAAAGCGCAACACTTATAACCAGGGGATCTGATTTCAA

GGAGCTTCAGGAGAAGGTGTTCAGTGACTTTGAAGAAGAACTCCATGTCA

AGTTCACGACTGAAGGAAAATCTCCTAGAAGTCAGGAAAAGTCTCATAAA

CTGAAACCCAGCCCGGCTTGTTGTGTTCAAAATGCATTGAAAGAGATTCT

TCTGGACTTCCAGTGGGACAGACCTGATTTAACATCACCCACCAAAGTGA

CGCTGAGACCAAGAAGGTCGAGTAGAAGTGGCAGAAACATCCCCTTGCAG

GACTGTGACATGCTAAGTGTTGACAAAAATGTCCTTTTTGTCGTGTCTGA

ATGTCCACGGTCCAAAGCAGAGCTGGAAGACTACTTGTCCATGCGTAGAG

AAGACAGTAGACATCATAAAGACATAAATGAGCAGATGCTGCCCAAAGGT

CTCATAGATATGCTTATGCAACGAAACGTTGTGCTTCACTGGGCTGATTC

AGGTGTTTTCAAGgtaaattgggctcgtgtaaagttcattttaaaaaaat

ctatcttttacttacactttaatttaggtctgcacgatattgaaaaaaaa

aaatcttcggggattttatccccatatgacaacaaatccaccagatgact

tag