nuclear cap binding protein subunit 2

cDNA: Genbank AY099530

 

hi1579 is in the 1st intron

 

ccatgggaatgaggggcaacggctgattagcaccggctgtatggctttaa

ttgtgtaccacatcgcagattcagttcatatgaatatggattatttgtaa

tgttttcataccgtcttcatagtctgccgttgtttctctcgctggattat

tttggccttttcttgctcttttctctctgctcgagcagaaacgccgctgt

ttatccgcacgtccatgttggatatcgctgatgacgtcacagaccgcggt

cttatcgcgaggaaaagcgggagacaaacgagaagaagaaatgtaaagtc

aaataatagtgggaaatatttgtttatttgtctcttcgcacaactgtttt

gctcaatgaattgttgcttaaattatttaagtagtaggcaaaggtaatca

acaatgtcgtatccttagctgctctcaacagtaggtggcggtaaagcagt

gtgagccggtgtcatgcacatatgaagaagagcgctttccgctttgtgtG

TCGTGCTGATTTAAACACGTCCAGCTTCACTTTTCCTCAATTAATTTGCT

TTTTTCACAATGTCCATAAAGTTAAATGCTCTTTTCAGCGACTCCTATGT

TGATGTGAGCCAGTACAGGGATCAGCATTTTAAGgtgagtgtaaaatgcg

cgatgtttaattgtgttcagctgttttctttgtatttttaatgt

hi1579 (3-5)

cttcctccttagtttaatcgcattatttgtttgtttatttgtttttgcag

gtaaacaaatatgtcaatgttgttgttgaaattgatttactgtttatatt

tctaccacatgctttatctaagggtataacttgtattagagtttgtttat

ggctgagagcagaaacactgagctgtactttagtctaataataagttttg

tcattggtatgctttggatatgccactatgcttaacaccacaaggtttta

cctattttatcagcaaaatgtttgtaataaagtctatttaaatgcgatat

gatcactaatgtgtttatccattgtaatgagtacaggtctgaatgagtgt

aattgtagattttcattaattgatcttttttttaaacctatgaagatttc

aatcatatttgactttttattattatttttatttacttatttattttatt

attaatattattattttgtttcattattatcataaacattgttacactta

cagttcctcaaaaaagacgagtgaattaaatagcacaattgtgatttata

tttgcagcagtgtttgcacatacactaccacactaaagtttggaatctgc

aagatttaaaaagttttttttggaaagatgaatcttagtattagaccgtt

cttgtccacaaactttataaccaaaaacagtttcccccaaaattttactt

acaaccgattaatgatatcatctgatgcttttaaaaacattctaatacgc

caaattgctgcaaaagagacatatcattattgatatcattaatattatta

ttattattattaatactatcattattattttcgtcattatcatcattatt

attattattatcatgattattgttgttatcatattattattattgttatt

atattactatcatcatcatcatcattattatttacattattatcatcatt

attattattaatatcatcttaattatcattaatataaatgttattgttat

tattttcatcatcattattattattattattttcattattattattatta

ttagtgattatcatcattataattaatattaatattattattatcatcat

cactattatcattattattataattattaatattattattattattaaaa

ttattattattattatcatcattattattaatatcattatcatgattatt

atttttcattaatattattattgttattattattatcattattattactt

ttatcatcattattattatattattattagggctgcccaatatattgttt

gatatcgcaatgtttgcattggcaatagtcagatctcaagatatgcattg

ttgagtttggattataaatgaccagaaaccacaaaacacatgagattagt

gcagacatggaaacacaatagagtataacatgtatcgtctgcatgtgttt

ttaaggcctgcgactgcgtgagcatttcagtagagcataaagaagtttaa

taaagatgcatttcatggaaatatttatatgatgaagactgcaatgttaa

tttacatttgattattcaattactgcagttgaaaacagctactctcccct

gaaaagcgtaacgtgtggtttatttctttttaatatttgctcctttgtgt

ttatttatgactgtattttgttcattatgtgtataataaaggacattcaa

atatgtttctatttcactgcccgttaaaatcattccaatcaatctaaatg

aaagactttccaaacgctgctatttaagtcatctgctgaaattgtattaa

tatcgcagagggaaaaaataacgcaatgtcaagttttctcaatataatgc

agctcatgaacagaattaaaaaaaaattattataaatattagaattatta

tataactattataatagccagctctctctttatttttatatatatatcct

atgtcatgtgatcaacatgcctttgctgaataaactttttttattattat

tattaggaataacatgtaataacataataatattaggagtaacatgtaat

aacaaaaataagaataaagttaatttaagagtagttctgcaagacagaag

tagatttcactcgtgaataaaacacacacataataaaatgcatgatctgg

tctcgttgtcagGGCAACCGTTACGAGCAGGAGAAGCTCCTCAAACAGAG

CGCCACGCTGTATGTAGGAAACCTGTCCTTCTACACCACAGAGGAGCAGG

TGCACGAGCTCTTCGCCAAGTGTGGAGACGTCAAGAGGATCATCATCGGC

CTCGACAAAATCAAGAAGACTGCGTGCGGCTTCTGCTTCGTCGAgtatcc

ttctaattagagctgcagcatagatcctgttagcgttgacgtcgcgctgt

gagcatccacaatg