mki67 (FHA domain) interacting nucleolar phosphoprotein

cDNA: Genbank AF506201

 

hi2827b is in the 1st intron

hi1581 and hi4003 are both in the 2nd intron

 

acataacatagcacaactgtcaacgccgtgagtttagttgacttttattt

tgtagcttttgcaggcttttattttgaattgtcgcttgcattagcagttt

CCTGAACGAGGCACAACGTGGTTTTAGGAGAAGCCATACGACAGTAGGTT

CAAAACGTTTAGCTTTATTTATTTGACCACTGTTAGATTTCAATATGACA

GAAGGCAAATCATCAGACAAGCCGGCGAAAAGACTGCTGGCTCTGAATCC

GAAAGAGGACGCAGAATTTCAGAAGAAAGTGCAGCAAGTGAAGAAGCGTC

CTCAAACGgtatgatgcgtggccatgtggccttagtttagcctgacagtg

cttcagattcacatttaaaacgtggttggaacaaaatgtttcttttaatc

actaatatgctgtagctagagttaagttcggtaagatgagtcttgtttac

acttgacgg

hi2827b (5-3)

tgctaatgtaatgttactatttggtttacggtgcacatgttacattcaat

attttgttttgcattgaatgcgcttcataatttgttttggtcctctttca

gGGTCAAACACTTAGTCCAGGAGTGCTGTATGTTGGTCATCTTCCTCGAG

GACTGTTTGAGCCTCAGTTGAAATCTTACTTTGAGCAGTTTGGCAAAGTC

TTACGATTGAGAGTTTCCAGGAGTAAAAAGgtatgacgtgcatttgattt

attaccttagtttataatgacatgacgttaaatataaagtaaattgctca

ata

hi1581 (3-5)

caaatggtcaagacgttctaacgcggactttctgaatctaatacatgtta

aaatgttaaaatcttgctttatttattagataaattgtattattttgtgt

ttgccagtactagtatatctaaacattttttaaagggatagttcaccaaa

aaattctgcatcaattactctttcactactttctcctctgttgaacacaa

aaggaaacaatttgaagaatgttgggaacttagcatggaatc

hi4003 (3-5)

ccatagtatgttgttcctgctatagatggaggtaaagttggttttgtatt

aggatattcagacatcctccttaatataattttagaaaagtattctttgc

aaattttaaataggaaaatcatattagcagcaaatgactaacaaagtaca

gcattgttcacagcgaattagatagtgttgatgttgttttgaaatcaaac

atgctagttcagactcgatattcaacatagcgtggtaaacaatatagaga

ctgctaaatgaacaaatgtgcaaatataaaaccaacttttcctccatcta

ctatagatgccagtggtggctgggttttcaacaatctgtaaaatgtcttt

tgataaagtcttatgattgagtttgcaggagtaaggttttaagcattttg

ttacattggtttgcaatgacctgatgttaaatatgaagaaaggtggaaga

agagtgaggtaaatgacagaatttagattaaactttccatttacgtaggg

tttattggcagatatttcgtttaataataaattaaataacatttggccaa

tttcacagagaattaagctttctttacttttgttttacaaataaaatcag

caaaagccctgtaatttccaaacaaaccaataagaattctacaaggaatc

ctataaagaaacgcataagatcctcttggataaatacgtttaatccaatg

aggcccaatttgattctaagaggatttttagagaaatcttatttgattcc

cagcgggttgctttcagataatcatcggctgcatctgaattgtatactct

aaccatttctcattaactttatagtagagaagtgtgcttttttctttatg

tagctgtaaacattctatcaggatcttgtgtttttttttctttctttttt

ttctcgtttttaatttctctatataacaacatgtttaaaaggcacaatct

gaaaattacctttggcattttgttgcgatgggtaagattattgtgccaac

attaattcggtacatttagcttattgccaacttcatgtagttgtgcaatg

aaacccatgtgcctacattaatatcacaatagtcatattgggtgataatg

ctttgctggaggttttacctcataaatgattgaactgtcatctttcacag

ACTGGTGGGAGCAAAGGCTATGGATTTGTGGAGTTTGAGTGTGATGAAGT

GGCTAAGATTGTGGCTGAAACCATGAACAACTACCTTATGGGAGAACGCA

TTATAAAATgtgagatgagagcatacaagattattaatcattattttttt

tgtctgtgtgtgatgttt