histone deaceytlase 1

cDNA: Genbank AF506201

 

hi1618 is in the 1st exon

hi2628 is in the 1st intron

 

agatctaaatgcataattaaagcagaagataaatcattggcggagaaaca

aaagaatcacgcctacagtgatggaacctgtaccgtgattggctcaaagc

tgcccgagacaagttgctattgaagttcctcaGTGCGCAGAAAGCCCGGC

AGGCGCAGGCTGTAATTGGAGGGTAAAATGGCGCTGAGTTCTCAAGGAAC

AAAGAAGAAAGTTTGCTATTAT

hi1618 (5-3)

TATGACGgtaagaatataatttttgcccctgcagtattaagatcttatgt

tcagcagaaataaacgcagtgcctgctttggatgaatcaatacttaagtt

cctttgagtgctgattaattgttagccgggtttagccgcacggtgctaaa

gctagtgtgttagcatagcctgctagctcctcttcatcctgttgttcttc

ctcactgctaacagcatggagctaacacaagcacaattcacactattctt

ttttgcaagtgtgcagaattctcgtacactttaccatgtgtagttttata

tcccgcgtattgcatcgataaaattagcttcatactgtggaccgaaagac

tttaaatgaattgagctctttgcttttattgatgcactcactgctagcat

ccgagcgtgtgtgaatgatgctctagtttaaaaatgtggactgtcttctg

ctttttgtctttctgcttccaaatatttctttgcttaaagtcccatatga

acattattttggattgtgatgaagtgaaggaggttgatcttgtagctggc

tttgtgtctagttgaaggcctattagataaagtgattgttccataaacct

agctaacgttaatattatttgtattattttcttcaaaggac

hi2628 (3-5)

atttttgtatttaattattttaaacacgtaacggtgtatctatagtttga

gttaagaatatgagtctagatatatattactatatttatatgtaacttac

tatagatacatatcactatataaacatatctatatatttgttttattatg

tcaatctatccatctgtcaatttttttatttattatattgttatttgtat

ttgaatgcatgttagactttttttactctagagtctagacttgtaaatgt

aaaaaatgtattctattactttttttaaaaattttttattttatttgttt

tcttttgtaatctttttgccgtgaagattactttgattccgacatgatat

taacaagtgaataaataggatctggaaatgtagtaataggggaaaaaact

atttatttttgttaatctgtagtatattgtacaattaaggaaaggatggt

ttaatatttgcacatttagactttatacttaataatatgatttcagaaac

gtattgctaattctaaatagtaaaatcatattagcagtcactgactttca

aactactacgttgcttacagtcaactaaacattgttaatgtttttgatgt

catatttacatgtgatctcaagccgaatatttaaagtatcatggtaaaca

atatagggagcatgccataaactctcactgaatgaatgcaaatatgaaac

caactttacctcatttgttttaccatatgaatacaataaatctttaggga

gggcatctacataaagtcaaataaactaattaaaaccatgcataagtaca

agaaaagtttcatatactaaatgtaatatacaaaagtgaaagttacaatt

aaaactgtcgttgtttttattttttttttaaacaaatttaaccatattca

ggtatggtaattgaatacaaaaataagaataaaaaatttaactttattat

agttcccaactgtacaatttctaatgtctgaatgcttataaaaccctctt

acaatctcaggcctcaataacacatgcacatgataaagtataatacatta

caaatcctgcgattaggcatgggccggtataagataataagatcacagat

tcacggttttatggtattgtgattactgctctaaagtttgttctctttaa

atgtcttggttaaaaaacaaacttttcccttttgagctcaatatattttt

aattttagaaacatttaaaatattttgggacagtaagcatgttggctaaa

ttaatcattgacttctgctggcttcgtttgtttcaaaaacacagctttct

tcacaattttaaagggcatctttggatatttttgtttgcctgtagatact

gtagtccaaaaaaaaaaaaagtcaataaattttttttttcatctaccttg

gaaatggtattacagagaaattcattgttttaaaacctcgactttccaaa

ccatggtttaccttgaaaacgggtatcgtcccatgcctacctgcgatgtg

acagttgtgagtgatcttattcaatgttgatgctgtaaagatgtattgtg

catccctttggataatgcttaaaagttgtgattgattttgcagGGGATGT

CGGGAATTACTACTATGGTCAGGGCCATCCCATGAAGCCCCACAGAATCC

GCATGACCCACAACCTTCTGCTCAACTATGGGCTGTATAGGAAAATGGAG

ATTTATgtaagggaaataaacaaatgcttataacttaagggatttgtttc

agggttctagcttagttgattttattttttcacttctttagCGACCTCAT

AAAGCCAATGCGGAAGAAATGACCAAGTACCACAGTGACGACTACATCAA

GTTCCTCCGCTCCATCCGCCCAGACAACATGTCCGAGTACAGCAAGCAGA

TGCAGAGATgtgagttgctctttttattttattattattattatt