suppressor of Ty 6 homolog

cDNA: Genbank NM_145118

 

hi2505b is in the 5' UTR

hi1621 is in the 25th intron

 

acagaaaccaagaataactcaattcaagtttatttgtatggcacttttca

tcttagtttcaaagcagctttacaaaaggtgcatatattactgcattata

atgttgaataatgttataatgattagcattattggttaacaaaaagtgtc

aaattcttcacattttataatctaagttaatttcatttaaacatttactt

gcggatatgcattgtacaagtactaaaaatcctaaaagtagtaataaaag

tactaaacatttgtatttgttattagactttaacatgaactaatattgaa

cgattcattatcattttaaattcatttttatgcattaactaacattgaat

aatggaattcaactaacgaatgtcacaaacttatagttataaaatagcat

atagagaaattggtagcaaaatgcaaataatttaggacatttgataaata

aaatcaaaaccctttcaatcacaacagcggcaccacgaccggaagttaaa

tatgtatataccggaaccagaatttcgactatatcccctcagccattttt

tgttgtcactttcaagcttctcCAAAAGTGACGCTCTATTCTTCATCT

hi2505b (3-5)

CAGCACTTATTTTCACGTATTTAACCGAGCTTCATTGCGAGGAGAAgtaa

gtgggcttttgtgcacgatattttattccaatatgccgttttataaagca

gcacgtatcgcctgtgttgtttttgttagcgcacaggttagcgattagca

tgagggccttgatctcccacagtgtcgcggacagattagtaacgtgatta

ttaaaatggttgtaaattattatttgctgttcaagttttatttatttacg

gcttttgagatatttcctaatgagtttaaggttgtatttacgcgtcctga

ttcatttgctaagctaagttattaagctagtcgcatggatgccaagttca

acttaatgtatattttggcatctgaaaagcttcaatttagaagtaatatg

ttgtgctatgtcttcacgttaagtgttcttccgaaaatgttatatacgaa

taatcgagctgagagaccagtgaagcttaaattgggcaggttgtctttat

cttttgtttactgatgaaattatttgtcagattcattttgaggtaaagtt

aaatttttttcgctaattcagactttgtccttaataatatagtttcaaaa

aagtgatccttgcaaattctaagtggttacatcaagtacatcattgttca

tcgtcaattaaattgagctagtgttcttttgcagtcagtattgcatgaga

cttcagacctaatattcaaagaaacatgttaaacaatatatgcaccttgt

cacaagttgtcactgaacgaatatgcaaatttaaaaccaactttacctca

accagattcctgactgttcaattgtttattgttgctatcattgataatct

gaattgtacagattatgttataatctaacgtttcacatatagttattatg

aacaccccaaaaccactaaatgccataccttgtttattattgtgatacta

tattaatacatagctcaaaatatagaaaattgtctgaaatactatatgtt

atatgtcataatacttaaatgatattcagaattcccttattattaaaaac

gtgctagttgtacagactctattgtatatactgtgactcttttgttattg

caataattaagaaataaagtggtcaattggttattttctttcacaaatgt

ttgagcattttagtgacttttccacatgcaacatattgtagaaccgttaa

tgacgatactactgttttcaaactacattggcaccgccactgttttggag

ccatagtatccgcggtgctactaaagtaccagtaaaccatgcaactctat

tataatgtgcgtttatttttctacacagGCCTTGCAAAGATGTCTGACTT

CATCGAGAGCGAGGCTGAGGAGTCGGAGGAGGAGTTTGAGCAGAAGGACC

TAAAGCCCAAGAAGACCCAGAGATTTATGGAAGAAGATGgtaagatgctt

cttgctttaaataaaaaaactaaatcttgaaaaaggcatgaaaattatta

aaatcatattttagtcttattattgatgttttcattcttg

 

much later in gene:

 

approx 4.5 kb from exon 25

 

atggtggagaaaaagcctttgtataccttcatacagttgtagaaacacaa

agtactatggatatcagtggctgattatttgtcgaatatttttcagtata

tctgtagatacaaggtcaggatgatgtaaatgatggatgaactaaatagt

ttggtgaact

hi1621 (3-5)

attccttttacatgagtttattgtgacttacttgtatttttttttttttt

tattgagactatttacttttttttatttattttttttaagtggaaacctt

accgaagacatttatatatgtatttagcatcacctacttgtgatctgatg

gacagaaatgcatcttaatgccagctgtaaacagggccagtgtttcatag

tataccctcattgtttaatgttagcaggcttcaaacgtaactgatttgaa

cacgtacttaactagacatttttctatcttttttagGGTTATGGTAATAA

GGGAATTACACTGTATGACATCCGAGCAGAGCTCAGCTGTAGATATAAAG

ACCTGAGAGCTCCATACAGACCTCCCAACACAGAGGAAGTCTTTAACATG

CTCACCAAGGAGACACCTGAGACTTTCTATATTGgtaaaccactacttga

ttgcttttagaaatgataaaagatcgtaatgatccatgctctgtgatatt

tatggtgatatttttgtatttttaatatataatgtaaatctttgtgcatc

tacagGTAAACTGATCACCTGTGTAGTAACTAACATCGCACACAGACGAC

CACAAGGTGAGAGTTATGACCAGGCCATCCGTAATGATGAGACTGGACTC

TGGCAGTGTCCTTTTTGCCAGCAGGACAACTTCCCTGAGCTCAGTGAGgt

gggaagcttttctgatatctttttaaaggaatgagactgttcattttagc

ttttgcacatcagtgaatgctgttaccatggtgttgtgtatttctcagGT

GTGGAATCACTTTGACAGCGGCTCCTGTCCTGGTCAAGCCATCGGAGTAA

GAACCAGGTTAGATAACGCCGTCATGGGCTTCATTCCAACTAAGTTTCTT

AGTGACAAAGTGGTCAAGCACCCCGAGGAGAGGGTCAAGgtgagttaatc

taacatcatctggcattgttcactataaatgctttgccttacaaa