knypek (glypican-6)

cDNA: Genbank AF354754 (5 UTR not defined)

 

hi1934 is upstream of the gene (or possibly in the 5' UTR)

hi1688 is in the 4th exon

 

aataaagtcgtgacttatttgctgtttgttacttttgctcgctttttatt

cggtatacactgcgggattgtttcgctcgttgttcttttcggaggcccgg

hi1934 (3-5)

ttttttattactcaagaaaatccagctcgcgagacccgagcgtctgaaag

aagttaaacacagaaagactccgcatccccatgaggcaaccagaagtgcc

aatcgaagagatttcgtgactgaaccttttgttttttattcatttttggt

gcttcattactttagcagtcagcgATGAAGATGATCGTTGTGTTTACAGT

ATGTATGTCTGTGGTGGTTTTGGCGTCGGCTCAGGCTGATCAGAAGTCAA

AGAACTGCAATGAAGTCAGAACTGCCTACAGTTCCAAAGGTTTCAACGTC

AACGATGTTCCCAACAAAGGAGTGCAGGgtgagttacactgattttattt

acacgaaatgcggtacacttgttaagcctgtcagattcgtttggtaggct

ccgtgtactaaaaaagctatgtaaatacacagtgcgtacagtttggcctg

gctacatatgtcgcttttgtatgtccagaaagcagtgtataaagtttgca

aggtgcttatttcgtgtccgcacatttatttaaacatctctattgaaaat

tattg

 

much later in gene

 

caggcatatgaattaggttacggactcattaaccttttctgtctgttttg

ctgactctgctcaattactcttcctgttcgtcctttttctcagGTGAGCG

CCTCACCGAGCTGTGTGCGCGCATCGATGAAGATGTTA

hi1688 (3-5)

TACTGCCCGTACTGTAGCGGTCAGGTGGCGCTGAAGCCCTGCAAGAACTA

CTGTCTGAATGTCATGAGGGGCTGTCTGGCCAATCAGGCCGATCTGGACA

CAGAGTGGAATAACTTCCTTGgtaagaaagacctgcagtattaacatgct

ttaaatgtgtccgcaattattagccctccttaattgttagttcctctgta

tatatttttttccccatattctgtttatcagaaagatttttttaacactt

ttctaaatataatagtttcagtaactcatttctaatatctgatatctttt

atctttgccatgatgacagtaaatacatttctactgaatattcatcaaca

tccaagtattcagtccttaactatgttaactaggcaagttagtgttatta

gtaggaatgtgatgtgattttttccaagctcaatggggtgacccctgtaa

tttgcataaatccaaagtatttttttttttttttgaggtggtggggtgtc

tacatgcagatgacctgcttcatttcagatgtctttcagggatgtaattg

tagacttacctaggctactgtgtttttaacataataatattgtgtagtgc

tataatgtgaggaagccgctgacaatatgcaagataaaactattaaaact

attaaaaacagggacaaagtcaaaggaaagggaaagtgaaagtgatgttt

ttttagagtggaatgttaaagtatattaggctgctcaattcaagtggact

taatatttttacagtttgaattgttgactgagtagttgtttattactttg

gaatccacttgttcacgcgagtgcttctggatccaagcgctctatccaac

tgaatagggagactcatcaatactttgatgtaatactttcga