aryl hydrocarbon receptor nuclear translocator 2A

cDNA: Genbank NM_131674 (5 UTR from AF155066)

 

hi1715 and hi2639c are both in the 5' UTR

 

ctgcagtttttaatttaaaacttaaacagatttcttttttccctaatgat

atatgatgtaataaatttgtattttaaaaatatgtttttttttccttttt

ctaatctttaggtaataccctgatctcagttcagagcctgcctgtgatgt

ctgtgcaagtgaccataacaaagcccccaacgcgtgagtggactgagccc

cgcactggtgtattttggagggcagaaaaagccgctgcgtggatcctgca

ttcattaattcagtgaagtctcgcggttgttcacgcaacctctcagacat

CTTGCGTTTGTCAGACCGCGGCGAATCTGCTCCACGCATTTACAGAAACC

GAGCAAAATCGCATCCAAGCATCGCTCTATCGCCGTCACATCTTCTTCAC

ATGCGGGGCTGAACTGAGTTTGCGCGTTTGAGACACCCCGGAGAGGATTG

CGTGCGGCGTTATATTCGTATTGTGCGTCATTTCTGCATTTCTGC

hi1715 (3-5)

GTTTCCAC

hi2639c (5-3)

CCAGGCAATATGGCAACACCAGCCGCTGTAAACCCATCGGgtgagtacag

gttttattctttcgcttctaaattaactgcgtgcggtgttcaaacgcaaa

ccgagcgtctgcgttcacccccagtattctgttttcgcgataaacaaaga

aagcgcgtcgcgtttaaacgtacgcgagctccccctccccctcacacaac

taacaacagcgacatttccgattcaaacgctacaatgtatcggttagaat

tctaaaatagaacgttcattctttcgcgacgtgccgtcgtcgcgaatgta

ttgtgacgtcggagggaaatgtgtctcgtttggcttctttctgtttctgc

cgcggcttgttgctaatgcaaatgagatgctaaatacatttgccacaagc

caagtacgtgctttgatttccttgataaggaactattggatctgatacgt

tgaatgtagcattgatctgaggttatgagagtatagctcgacttcctctg

cctgttgattgtgttgcgagaatgaattctgatgggcaaacagtcaaata

tattttcatatatacagatcagtaaaatgcaaattagtatgtcagcatat

ctattatgtggatcacacatttgtaagtagcatatctatgatggagagat

gaaaaaaaaaaagttattgggcattgaaagattgtaaattttacagtgca

gacaaaacttgtagtttattgagcctttgaacaaattgtaacaaaaaaag

ttgattgcaaatagatct