programmed cell death 7

cDNA: Genbank AY648747

 

hi1722 is in the 1st exon

 

ctaaatatgttttttcaaatgtttaaaatgtttaaataaatgctaaataa

atgttttgcagttttttaccccgccgctttaagaagattcaggggtttta

ctttgaagcgatgcgggctttattttgaaggcgtccttcacagtttcctg

tttaACGATGTTCTCCGAACGAACTTCACAACAGCGCTCTTGAGCACAAA

ATTTATGTTGATTTCGGCTTAAAATAATGGATAATTCTCATCAGTTCGGT

TATATGAGGGCTCCGCCACCTACATTCTCTGATCCCGCGGGTTTAGATGG

CGCTGTTTATCCAGGACCACCGCCTCATCATCCTCCACCGCAAGCGGGAT

ACTCGTGGGACACTTATCAACACCCTCCACCGGCAGCACAGCACCACTGG

CCCCAGTTTCCACAATTCGACCCCAGCAGACCACCACCAGGGACGTTTGA

ACCTCCTCTAAACCATGAAAACCCACCTTCGTCCTGGACGCAGAACCAAT

GGAGTAACGTTAACGTTAATATAGACTCTCCAAATCAACCACAATATCCA

AATTCAACCCCTCCCTCATATCAACCTCACAGCAGACCGGATAATTCAGC

TTATATATACACTCCAAAACAGCAGAATTACACATTTACT

hi1722 (3-5)

AACAGATATTCCAACGAGCCCCAAAACATCCAGAATAAAAGTCCCTTAAT

AACCGCGTCAGATGAAGAAGCAAAGCAGAGACTGCGAGACGAACAGTGGA

TTCAACGTTTCTTGCGGACTAGAATCAATTATAATAAACACAATAAAACA

AAACAAATTAAATACAAACCGTCCATCTCTGAGTTTAAAGAGAAGCTGTA

CGGGACTGTTCAAATGCTGGCGGACTTAAATCTgttctgtcggaggctga

aggataacctggagaatgaagatgtttggacggagacacttttaaaagcg

acagaaatgaagaataacctacagaagagactgaaggatctgaaggagcc

cgactgtatcagcagcgtccagagaaaattacaacaggttaggtttatga

tgatcatagcacattttcttgttgcgatttaattgctcgtgcttttatcg

tgtaatacggtattatcgcggtattagcactacaaaaacgctacttttac

atgtataatagggtatatgt