DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

cDNA: Genbank AY648748

 

hi1727 is in the 1st intron

 

caaccaatgacaagggatcaagcatggatttgtggaatatcgaaagaata

tttccattatttcaccactagagagcagaaatgcttgttatgacatttca

gatatgtactgtgtacgggttaggtcagctctgctgactgacaaatatta

ttacttatatattgaagcattttggcaacctagttttgcaggtactcact

aataaagaaggtttctaacatgtttttgtttatttatttattttaatctt

ttttatttatcagacttatttggttcctatgaggggaaaacagctagtaa

ataatacagaattaggaaatgtaaagaaacgtcttgaaacacataaacac

tcgtaatgtaaggtttagagccaaaaactacattttactaagctaaaatt

gcggttaatttttgtcggaaatataagatgttaacttgttgtaaaatcgt

taaaagggtgcacatttattgtttgtttgttccatacagaaaaaaataca

gctgtcgcatctctgacagtaaataaatgattaaaattcgagcctaattc

gcaaaaaaatattaaacatttttatgtaaagtataggtcgccgctggcaa

caaccgagccgcacgatttatgtatatttaaatgccttaaacattttaag

tcaggcaaaaaatgagtcagtctgcagagtgaaggaccccacgcagcacg

cgcacacgTGTTTGTCTACAGCCATGGCGGACATGCAGATGAAGATTCTT

CGCAAGAAAATTCAAAAGATAAGCGAAAAAAATAAACAACGCAAACTGCT

GCAATCTCAGAAAGAAGAAGAAAACAGCGAAGgtaatgtatttacgttga

ttatagacaagactgacgtgagttagtgttgtgtggcatattacaaacac

gctggtcttaaacgcgttgtcttatacaagttttgtcttatattttactc

agatttctttaatctt

hi1727 (5-3)

ataacacatatgggtttagttttatagtaatagtaattctaatcgtggct

atgtgtgatttaatgtctatcttcaggaatatattaccgacacaccttac

tgaggtaaagttggttttatattgactcatttagactttctccttaataa

tataatttcagaaaacttatttacaaattataaatagtaaattcatatta

gcagccaatgactatcagagtacagaatttttcattgctcacagccgatt

aaatagtgctactgttgtttttaagtcatacttgcgtgtgattttacacc

gaatattcagagtaccatggtaaacaatatagggagcaagtcacaagttg

tcactgaacgaatgtgcgagtattaaaccaactgtaacgttacctcaata

cacacctttacttattacctcctcaaatagcctgtagttgcataactttt

cccctttggtaaagttgttgaagtgtgctgtctgtgtttctcatctggca

gACGTGAAGGATGTTTTGGATGAATCTGAAGTGGCCAGTGATTCTGCTCC

AAATGTCATCGAAGAGCAGCAGCAAAGTGTCTCGGATGAAGTGAACGAAA

CCTCACAGAAACCCAAGAAGAAGAAAAAGAAACGAAAATTAGATGCTACT

GGAGAATCAACAACATCCAgtgagtgtttaatgatgctgtgcatgttcag

aatagttcgtgttggtcactatgggcttgtgatgagtaactatagatgtg

actctagttggattttgattgtaatatttaaaccagagatgcttatacat

gctagcataatttggcccaccatcccatctaagatgagagggagaatgat

ggggatggtttagagattgtcatttcaagtttaaagtaaccttttattta

tttgttaattttttttgttaagctacaaaaacctaactgaaataaaatgt

ttcaatttaaagctgtcatttaatttaacgttcataatgtcacccaacgg

atagagggcaatgcagagacttgggtgagcaaaccaaggcaaaggcagat

tctgctggactagtcgactcgtcgcc