kinesin family member 23

cDNA: Genbank NM_131355

 

hi1730 is in the 1st intron

 

CGTCGTGGAATTAAACTAAAACATCTCAGCATGATTAGGCAAGCgtaagt

attttatgccgacttgtgttttagttgtgctaaatagataaccagtaatt

caaagttcgtttagtcagtctgttgtttcatacggacgttgagtggtgtt

cagcaggcatttgttaacgttagccatctagtgtaactcaccgcctgttg

cgtttactttagcgttaatcgtttagaattaatccaccgtctctgcctaa

gaagttttactttatttctctactttactatttgttttagaagtttaata

atttgttatctacattattatcgataaacgtcaaacattatatttagt

hi1730 (5-3)

ttcaaattccagatttagtttaacgttagattaaaattgtataagttatc

tactgattgtctcttttatagtgtaactctaaaacgtcatttaacgttat

attaagttaggactcttcatatttagttcgtctatttttattttaagtcg

tgtttactaacttgtatgttgtctgaatttattgttaaagGAAGGGCAAG

ACCCCCCGCCGCCCTCCTCCAAAAAAACCTTCAAACAACCAAAAGGACCC

TGTTGGAgtatgttgtaacttgtcctcacatttagttaatcgaaattgtg

ataaatatattaatttgagatctctttgacagGTGTATTGTCGAGTTCGG

CCACTGGGTGCTGAAGATGAGGAATGTTGCATTGAGGTTATAAGTAACAC

CACCATTCAGTTACATGCTCCTGATGGACTCAAAGCCAACAGGAATGGGG

AATTCAAAGAGgttagtggacgtgtgccaaccgtttactcataagaagtc

attgaggtaaagttggttttatattcgctcatttgttcagtgacaacttg

tgacatgctccctatagtgtttaccttggaactttaaatattcggtctga

aaccacatttacctatgacttcaaaacaacaatagcaatatttacttgac

tgtgaacagtgctgtactttgatagtcattggctgctaacatgatttctc

tatttagaatttgtaaacacttttgtgaaagtatattataaaggaggaag

tcagaatgtgccaatataaaaccaactttacctctatttaagaagcctat

ttttttgcatttcgtgaggaattgaagagttaatttatcttgcactcatt

tactcactctcgtgtcattccaaacccagaacacttttgttcatcctgaa

aacataaatgtagatattttataataaaaaagtgaagtatttctactcca

ctgttaatgtattca