heat shock 70kDa protein 5 (glucose-regulated protein; immunoglobulin binding protein)

cDNA: Genbank AY648749

 

hi1743 is in the 5' UTR

 

 

CAGTCGAGGCTCAGAGAAAACACGAGAACACAGAAGACGGGAAGAATTGC

AGATAGACGTTTCAGCA

hi1743 (5-3)

CACGCCCTTCATATTTAACAACATTATTGTATTTATAAGgtaagaactat

atctcatttaatttcccgcttcgtttaattatgtcaccaaaaccgttaag

gatgaaattgattccttatataactgattaaactgcatagtcctgataaa

tatctttttcgtttgtgtaggttacattaaaatgtccaaaaatattaaaa

cgcgtatttaaatgttgttattatagg

 

approx 1.1 kb to first coding exon