surfeit 6-like

cDNA: Genbank AY648750

 

hi1769 is in the 1st intron, before the ATG

 

acacacgtggggcatgtttctgaattcatatatggcagaattattagggG

TTTTATTGTTAGTGCGTATTGTGGTCTGATTCGCTTTGTAATTTCCAATG

AGGTAAAATGTTTTTATAACTTTCTTCCCCATCCAACTGATGAATCGCCG

CAATCAAATCACCGAAGTTGTGCGGTGAAATTTCTGTTGACATTTTCAAA

GACTGTGTGAGgtaaaccaatcaacatttatctacttcggtagtcgacgt

gtttgttattgttatccaaaaatactgcatgaatttcatagaactctgac

tgctaaaatcataagtaatgt

hi1769 (5-3)

gttgctatcagatgtttagtggccaatgttgtatgtttacacatttatta

tattgttaactttctgttatagGAAACATGGCCAGCCTTGCTGCCAAGTA

TGATTACCTGGAGAAGTTGACACGTAAAGTGTGTGTGTCTCACAAACAGG

AGCCAAAGAAAAGAGCCTATGgtaaagttttgatattgaattgacacttt

cataatgtcataaaatttgaaaagtcttgtaagtaacaatccagggtttt

ttcaatcaggatttcattaagtgctctatagagagtttatatggctggcc

gatatgacaaaaatctcatataaaaaaataagcaggaccgtagccagcct

ggtgaaaaggaggcagttattcacctcattttctatttaactaagaagtt

aagtatttaacgttatggttttaatactgcgttttagtgacattttaagc

actatttatttagtgattcgattgccgggtggtcataaccacacttattg

atgaaccaaaaacatttcctaaagattaagaataaaggaatatgaaaaaa

caagtattgataagtcttatttttatcatgtatcattaagaaaaaaaagg

aaccttttaaagttttaaataaaaaataaaaaactggctattaaggctaa

gtaggctattttcatttaatcaaataacaaactggccagcacatttaact

tcagtcagaaattggccacgcgaataataaaaaacatataaatcataatt

attatccataatgaagagcttcccgatttttgtatcttgaaaaaagtaca

tttg