splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)

cDNA: Genbank AY648751

 

hi1779 is in the 1st exon

 

tttacagtcttttcttgcagccagcggccattttacaaagctgccgccga

GCGTGAGGGTGCTCCTCTCTTTGTCGGTGTTTATCGTTACAGTTGCATTT

AGTACGTGATTTAAAACTCACCAATATTCATTTTTATACGGTTTATCCCG

TCCGCTTCTGTGTGATAATGTCTCGTGACCGATCTCGTAATCGTGGAGGA

TTCCAGCCCCGAGGCCGCGGAGGAATGGGGATGCGCGGTGGCATGGGCAT

GGGGATGGGTATGGGCATGGGAATGGGAATGGGGATGGGGATGGGAATGG

GAAACCCGAACTTTCGAAATCAAAACCAGCACCATTTTCAAAACCGAGGC

CCACAAATGGGTGGTGGATTTAGGCAGAATCAGGGAAATCAAGGCAACCA

GGTATCTACACAACAGAAGCCGCAGGAACCCGCACAGAACAAGCCCGTCG

TGCAGACTCCTCCTGCGCAAGGCCCCGGTCAGGCCCAGCAGGCCGCCAAC

AAAGGCCCGACGCCCCAGCAGACTCCCACCGTCGCTCCGCCGAAAATCCA

GTCTGCTCCACCGAAGATCCAGTCTCCTCCGCCGAAGATTCAGTCTCCTC

CGCCAGCACAGAATAACGCGAAGACGCCAGAAATAGCTTCCCCTCAAAAC

CAGCAAAGGAAGAACCTACCCAAACCCGCGATGGGGAATGGCCAGAAGCC

GCCTGCTCCCTTGAAGCAAGAGCAGACGCCAGCACCAACACCCCCACCAG

CACAACAACAGCAGCAACAGCAACAAC

Hi1779 (5-3)

AACAAAAACAGACTCCCGCAAACGAGCAGAGCTCTCAGCCCCAGgtaaat

atatgaacgttttaagtctaataaagtcgcccacctcagaaatattacca

tttgcaatagttagaggcgcaaatgtgtcgtcttgaaacatgtgtcggtt

actaaagggctaggatgtagccgaggcagatccgccattttatagagcct

ttaacaaaggctgaacgccgcaccggttcctcgtcgcccatttcagtata

aaaatgcattttaactgcttggttgagatagtgagttgga