cell division cycle associated 8

cDNA: Genbank AY751743

 

hi1780a and hi2039b are both in the 2nd intron; however, due to polymorphism, the sequence of the intron is very different in the 2 insertions

 

1780a polymorphism:

 

ctgcagcgataacaacgctgatccgggcattactgacggaaacacagcga

ttacattaatcacactctgcgatctctttattacactgaccaatcattgt

taagtttagcgagagtgaatacaatgctgttttcattatagagtaaaacc

acgtgtgaccacagcgatcgacttttcttccgggtaaatgtaaacattat

gatcatactccaatccgcgtgcttgtttctttggctgaaacagtaaagca

ctcaaccattggtcagattctttatttgaagagacacgatgattcattgg

tcaaagcatggcgcatgttcacggatgctgcatgctgattggttcGCTGA

TGCGAAGCGTTCAATTTGAAAAGGGTTTTCATTCTAACCGCTGACTGAGA

GACACGGTTCTGACGTGGAAAGAgtgagtaaagtaagttaattttgtatt

atattattaaaatgaattcatttatattattatctggtactagaatgtgc

taatggtaatgaaatatgacgaaaatacgatgaaatagcagagtaaaagt

tcaaaattagctagttgtttgctacgataaaagctaacagatgctaacag

tgtctaaattaatgctaaaatctctttaaatctcagacatttgtgtcaga

ttttgtcaataaaccgtgtcgtgtttgttttccagGTTGATTATGGCTCC

CAGGAAGCGCACTCAGAATGCTAAAAGCAAGAAGAATCCCAAAGCGCCCA

AACTTGAGGCTTTTCTGCTGGATTTTGATGATGAAGgtcactccagtttg

tctttataaagctttaacgtgtaaatctattgagatgaagttggttttgc

atttgcacattcgttcattttttttaaaccgtgacaccgtgtctataatg

ttctttataatcggtctgaaatagcatctaagtatgactaacaacattag

cactatttaactgactgtgaacaatgctgtaagaattgaaatattgcaaa

tattctgatatctttgacaattcaaaacatgagctaaaaacagagactgg

tgacttcacaacccaccagggaggaatgcgggaaaaaccagttcctgctg

catttgcatctgagtctgcttcatccccc

hi1780a (5-3)

caactcacacatatggtcatttcaatgtttgaatgttctagaattaacca

aactgactttaactatcatg

 

unsure how far to third exon

 

 

 

2039b polymorphism:

 

atgtaacattatggtcatacaccaatccgcgtgtttgtttctttggctgg

aacagtaaagcactcaaccattggtcagattctttatttgaagagagacg

atgtttcattggtcagagcatggcgcatgttcacggatgctgcatgctga

ttggttcGCTGATGCGAAGGGTTCAATTTGAAAAGGGTTTTCCTTCTAAC

CGCTGACTGAGAGACACGGTTCAGACGTGGAAAGAgtgagtaaagtaagt

taattttgtattatattagtaaattgaatttatttatattattatctggt

actagaatgtgctaatggtaatgacatatgacgaaagtaagatgaaatag

gaaagtaaaagctcaaaattagcttgttgtttgctacgataaaagctaac

agtgtctaaattaatgctaaaatctctttaaatctcagacatttatgtca

gattttgtcaataaaccgtgtcgtgtttgttttccagGTTGATTATGGCT

CCCAGAAAGCGCACTCAGAATGCTAAAAGCAAGAAGAATCCCAAAGCGCC

CAAACTTGAGGCTTTTCTGCTGGATTTTGATGATGAAGgtcacttgagtt

tgtctttataaagctttaacgtgtaaatctattgagatgaagttggtttt

gcatttgcacattcgttcattatttaaaccgtgacaccgtgcctataatg

tactttataatcggtctgaaatagcatctaagtatgacttcaacaacatt

agcactgtttaactgactgtgtacaatgctgaactttgatattcattgac

ggctaatatgatttcactgtttagtattctgaaagaatactgatgttatt

ataaggagaaagtcagaatgtgcaaatataaaa

approx hi2039b (5-3)

ccaacttcaccttaattataactctttatagcatgaaagcatgtcgtttg

tgttgtctttacctgtttgtgttgtgtttgtgtgcctgctggttgtttgc

agTTCACACCATTGTGGAAAGGCTGAAGGAGAAGACTAATAATCTGCTGA

AAGATGCAGATAATCTTTATAAAACTGCTCTCATTAAACTGCCCATGGCG

GTGAGGAAGATGAACTGGATCGAGTACTGCAgtaagaagattcttcatct

gtctgtttaaaataagatcatgggtcatcatcatcttcattgttgta