wingless-type MMTV integration site family, member 5b (wnt5b)

cDNA: Genbank U51268

 

hi1780b is in the 4th exon

hi2735b is in the 4th intron

 

tcgagcaaaagttgtatgtctaaactgcacagcacagtctcccctggtaa

tagatcgtgttgattgaccattattgttcttgtgtgccacaaactcacat

aatggaggtggagcatatccatttaaaattttaaaaatcatacaagcatc

agccaaatatttcatattatcaaagctcaataaataatgtttttttgtta

ttttacaatgatgatacctaatagatttcccattatatacatcattaggg

tagcctgatgaagttttacattataaataacaatttagagtcacaaatag

tcatgcatatttaatcctgtgctatatttagctgatggtaaaagctttgg

tcttgctttctcagGTCATTAGCCATGAACCCCATCCAGAGACCGGAGAT

GTACATCATTGGAGCACAGCCTCTGTGCAGCCAGCTGACGGGCCTATCTC

AGGGTCAGAGGAAGCTCTGCCAGCTCTAT

hi1780b (5-3)

CAGGACCACATGGTTTATATTGGAGAGGGGGCGAAGACGGGCATCAAAGA

GTGCCAGTATCAGTTCAGACAGAGGCGATGGAACTGCAGTACAGTGGACA

ACACGTCAGTGTTCGGCCGCGTCATGCATATAGgtgagttgacctggtga

tctctaaaagtacatggctaaaagactaaaagtggagtatatgccaaatt

atcttgttaggtgtatttagaataaaaatcatttgatgccatctttggat

aacactgcagcaccaaatactaattacttgacattttcattatttattct

taaatctgtccttcaaatgacccatttgccagcctaacattttaattatt

tcaaaatataataatttagtttgatcacttgttatttttattagtcaaga

gaagtatgttgtttattatttacataaatgtgtctgtcacactgaatgac

aacagaacttttttcaccaatattttgacattgtgttttttacaaaagtt

gtttgcaacatttaatcaggctttttatttgcttttaatatgctttctgg

gtttataaaggcacatttgtaaatatagtttgatgcagacaatatgcacg

tcttatgtttgacccacatgcactcaaaacaagtatctaaaattctgaaa

tgcacaataataaatcatgaaacctctgaatgcatgtctttttaagtagt

attgatgttaaaggagttcatatgttttgtccagactccagagaagttat

caacaatatctgaaactactcattgtctttaacatgtggctggtgtaggc

ctaaaaagccacatgaccaggtgtctattaacagtttgagttaggaagct

tcatggataagttaaacatgtagttatgtcatatttggaggatattaaag

ggtctattcatcttcttgcctttgtcatatatgct

hi2735b (3-5)

tagaatgcataaacatggaggttgttatattgataaataaattttaattt

ttaattagcttattgattgcacgagttataaatcaataataaatatcagt

tgattcttgcatggtcgtctgtatattttatcattctgctttatggattg

caacgttttttttctgcag

 

approx 3.5 kb to next exon