ribosomal protein L7-like 1

cDNA: Genbank BC057532

 

hi1793 is in the 1st intron

 

GTGCGACGGGAATTTGTCACAGCAAACGCGATGGCAGAACCAGGgtgcgt

attttacttatttcgaatcttaatcaatctgtgatgaagatcaaaactat

tatctagtttttttcgttttcagcgtctatatagtgtgtatagattgttg

gatacaaaatttatccggatgacacaatgtgatgagggtgattagttaaa

gtttgttttcacatggatcgactctagtctacctgaactaacatgaaagt

tgtttttactattgtttttttttgtaattttactttagatcttaaagact

gtctggctgttctgtcatgtgtagatgtttacaatggacgtactgtcacg

gaattatttgtagttttggagttcgatggcagggctcaagattaacattt

cagagcagtggcaccgatgccaccaacttaaacatatggtgacatacgct

aatgattttgtgtttggacagtgctttgaaagaaatgaaaaaataaaatt

aaaccaacactaataataaatacagagatggctcaaagatatgcgaacgg

at

hi1793 (3-5)

aatttaggtaaatttggtttagtattcgcacattcagactttcttcttaa

taaaataacttggggaaatataatttttttgcagatttaaaacagggaaa

tcatattagcaggcaacaactctaaaatagtgctaatgtcgttttgaagt

catacttgaatgcgatttcagaccgaatataaataaactcaaaaactcaa

taaactgattaaaactacatttacatttacaattacgttatttgataaaa

ttttttaatgtgagaatactagtcatagacactaaaataagttcctaaag

gctagatttaatactttcttgctgaaatttcattcaatattgaatctcct

aaccttattgataatgatagaaataagtttcttaaaggatatgataatct

aattttttcttatttaatttttttcttcttcaatgcagtgagtgatgtta

ttattctatttagcaaaaaaaaggatactagtcatagtgaatgtaaagat

gcttccgtttcatagtcagttaacatgctttagctaatttgttgtagcgc

ttggtaacagctgtaagacattttttattaaaagcaacaataaaataata

gcataagcttttgtcttcagtgatctgcattttgttgaacaagtaaaatc

agtagacagagtgtttatttacagataagtgtggttacatcactgagcca

acttcttgctgcccattcctttaaatcaaagagcattgtctgttgattct

ctttacaggttttatctttatattcgtctttaaataaaaacatttaccct

tatcataaacaaaataatagtagattgaagccatgcagataataaattgt

ttaaggtcttatatagtttatattaaaacattgatatcttttgttcagAA

CTGAGAAAGTGATCAAGCTTGCTCCTGAGAATCTTCTCAAGAAACGCAAG

GCATACCAGGCTATCAAAGCCAATCAAGCTAAACTTGCTTTACAGCAGAA

GAAAAGGgtaagaattcttctatgtgttaatagtccaataattacttcaa

aaacaaactaataaactaaatatttcaccagGTCCAAAAAGAAATCCCCT

TCAAGTTTAAGCGCTTGGAGGAGTTTTTGCAAAACAGCAGGAGAAAGCAT

CGAGATGAGACCAGGCTCGCCAGACTCAAAAAGAGACCTCCACCACCCAT

GCCACCAGCCAAGAACAGCCTGGCATTCGCTGTCCGCATTAGAGAgtaat

ttacactcatgcctcattcacgttgacattgaagcttttctattatgctg

ctacacttttaactttctttggagtttaatatggctgtttgaccatgaga

aaatgtacaaagcacaaattatactacaggtatgatttttctggactctc

tcaaacgccttgattctagtccaaaatgggagtaattttcaccctaggca

agcccaatagggttacacagtccaacgacaccttagactcaagttacatc

ttataaaaagagcataataggagaacttcaaagaaacgtttgacccaaaa

atataattgcgtcataattggctggccttcatgttatttccaacaatgtt

ccatgttattttcacgatgcgtcatcagttgaccatattggaaagcaaag

cgtaaacaatgccactgaatgaaacttgcatattttgctgaatactgctg

ttgaaattagtttttgtcaagttttggcctgtacttaagcactgaagagt

actagaccgacaaaagtgagcaaattaaacagaagagagctgtttgacta

aatattacatattttcacacttaccaagttttctgtataatctagcacct

tagactaatttttgtcttaaatgcagaacagtatattcagtaattgatta

ttgtgcgatccatgatgttgtttacatctgagcatctacgtcatgactgc

acgtatgggtaactaatgaaatgatgcaagatgcatttttttgtgacaat

caaaagttttgttttaaataacatagcagtatgtgatgacttaagttgtt

tttggattaaccatcctttaaggtttattaccttagtttttattagggtt

taatttaggtttttcatttattgtagGATCAAAGGTGTGAGCCCTAAAGT

GATGAACGTTGTTCAGATGCTGAGACTCAGGAAGATCTTCAGTGGCACCT

TTGTCAAAGTCAGCAAGCATTCAATAAACATGCTTAAGACTGTGGAACCT

TATGTTGCGTGGGGgtaagtaaatatatagcgaaatgtttttaatttaaa

aactaaaggctggaatgcactacgtatcagactcttgcagacctggttgt

aaatagttaaaataaagctgaaggaaacagcatgagagttgcattggttc

ttcatgcagatggaaagtaaagtaaatcttatattaattaatagatggat

ggattgccgctgattaggtgcccatgg