60S ribosomal protein L36

cDNA: Genbank AY561518

 

hi1807 is upstream of the gene

 

agatcttttaatcagtagatggcgccattaatattccccgcgaactgctg

tcttttccgtcgcgtgtgaaagttcagcttccgcctgacagcggtccttc

cggtttggacgccattagcaaagagcaggtatgaatctccggagaatcac

aagcgttaaaatcactttaatatcttacacatcgagtgtaaaatcacgac

agaagtgcttgtttttgaaaatatgaagtttaaaaaacgatttccgccca

ttattgtgaaggtttatcacgatgttcgtctatttttaaggcagtcgctt

cgagtagacgcgaaaaagcgctcagatggctttctcaaacgctgccgtta

caaatttaacaaaacgatgacgaattaacaattcagacgtgtatacgacg

ttgcatttacatttcttgcttgttttatattggtatttaacctttttgag

cgcgtgtatgtaatcttaaccagcgacggcatgcgaataaccatattaac

atgtatttcaagcgtgtttgtacatatgtatgaacaagacatcctttttt

aaaattgtttattaaatattaactatgtctgagctcttatgtgacgcgtt

aatgtcgagaatgaagtatatgtgctttataacctaactggtgt

hi1807 (5-3)

aagaatagttaacgttattcaggcataattacacctacaaagtcagaata

ttacatctattaaatattcgtacattgcagtgagtttatataaagcacac

atttctatagaaaatataattattatttatcattataatgctgtttcaca

catgcttattgcacaattatatatagcacattatatttaaacatatatct

aaccaaactatttttattttatttacacgtaacacttataaaacatttat

atttaagcacacatgcagtttaggatatgtttgtgtagtttattttgttt

gtactgtacatgtattcaagaatgttatctataatttatatctaatactt

cagcccagctatgttctctcactgtgttaaattagcagtttacctcctat

aaatcacttatccatcaccacacgggccttttaggacagatttattctgc

atgtttattcaagaataattacactcaaacagtagaatatgctattattt

tttaactctacataatatatacagtacataagctcttattcagcacacaa

atgtcttaatactttagcacagctatgttctcttactgttttaatatcac

agtttaccgcctataaaacacttatccatggccacacatgcgttttaaga

cagtttattcaagaatgtttacacttaaacagtataatctgcctttttta

ctaaattgtgcttatatatagatatatagatgagcaattccagcattatg

gatgtgacatttgcagtaaactcaacataaatttgcatagaacgtatatg

ttagcattatattgaaacttttgtttatattttccagaacaactgaccac

agagttatgggagcagaaaaatatcaatttattaacatgttttgtacttt

atatgaggaaaataaacgggcgttatggatgtgacaaaaaaagtctgcgg

gtttacagtacacaacatactttgttgaaaatctgtgaattaaactgcac

aacccaaaagacgcaatgctaatcaaatggataagagttggctctctata

aaacaaacgtgattaatttaatattttcacattcatgaggaaaaagttat

ggatgtgacagatgtaaaattgccgcttgtgtgactttggtaaatctaat

agaatagtttgaaaacattgacagatgcatttttgcttatttctaaagta

ctggaaaatacttgtttacacaaaaaaaaaaaacagaaacctgttccgta

ttttagtgaaaacgtagggtttttttttccatggcacattgacatttgca

cggtcatattcatatattattattaccgttatgagcccttataaagcacc

cagatgtctaatatttaaccccagcgatgttctctcactgtgtatttaat

gtaaggattaattgatgatgagttagaaaatgatgtgcagctaaggtgaa

gtgtaggagtgtttattttctgataattcaaccactcagagtgcattatt

ccacttctactcttatacttgaggctaaaactcgcaattcagatgttgta

tttaagacatttgtgaggtttttgtcttaacttttttgtttgtgttggac

tggtttcttgcacatctccaaagccttctgttgtgttttaatgtgatttt

tgacgttaatactgaaatcctgagaggttgtgcatttaaaatattgagat

ttctcttgttttcttgtgatcacgacctaattttcttgggatctcagcat

aatatcacaacttaatatttctgtttttattctattattatttttattat

tacttatgattaatatttagacttttcctggtcatatattttattatata

gacctataattgctcactttttatatttagagaaaaaaaaaatggttacc

ctcaatatttttctgcctattcagcattagaggatgtccgtgattacaag

cagtaaatgcacagtattattcggattagattagcagggactcgtttttc

ttaattatttttaagtaattgaaaataacatttttgctttaatttattct

attaatttttatttttttaattgcttaatgaaaagtcctgccaaatttaa

tgcggaatactaggcacttactgctttgaatctaggacctgctcttatgc

caaaatattgttaacaattgttaaaataatgtgaaaacaacttttgatat

gtcgaaaacgagaaatacacagggcctctaaggatttcatagttgtgaaa

taactgaaagtgtagtgatatgtagctttaatgtgctcaacctgccggaa

ctacttcagctgtgcgtttatctgataataactgcacaccttacaatgct

catcggccaatcagaatcaagcatttagcagtctgtattgagaatgacta

ttgaattgttttgtgtttccgcAGAGATGGTTGTCAGATATCCTATGGCG

GTTGGCCTTAATAAAGGCCATAAGGTGACCAAGAATGTGTCCAAGCCCAA

ACACAGTCGCAGGAGAGGGgtgagtgcttatttcacacacttgatgttta

aaacagggttcccttgggttgcatagttttttgaaattttgcttattttt

ggaatgttgcttattttttgtgatatcatgtaatttcttggaatgttgca

aattttttgtcatttcgcataatttttataatgttgcgtaattttttgga

atgttgcgtaattttttgtcgtttcacgtaatttttggaatgtcacataa

tttttggaaagttgtgtaatgttttaaattgtttttggaatgtcgctaat

tttaaaaaatgtttttaaaatgttatttattggaatatcacaattcttaa

aatgtcgcttatcttttggaatatcacaatttttggaatgtcactttgaa

tgttgcgtcatttttggaatgagaattttaaaaagtattctagacattca

aataatgtcagggtaatgtgttgatttatttgtgcactaatctaattagc

atctttgaatggaaacaaagctactaaaagtcgttgggttgagtggcaat

cttgttaaaatcctataaacgttaaatattcaatagattttttgtagtag

tagtagttttgttgttgtttttccccatcatgcattgctggtgtggatgt

ataacatgtttgttgtttttcagCGTCTGACCAAACACGCTAAGTTTGCG

CGTGACTTGATTCGTGAaGTGTGTGGTTTCGCACCCTACGAGAGACGCGC

CATGGAGTTGCTGAAAGTGTCCAAGGATAAACGTGCTCTCAAGTTCATCA

AGAAAAGGgtacgatattcaatttcattagtgttccactagtgcagcgtt

tcccaagcctgttcctggaggaacaccaacagtatatattttggatgtct

cccttatctgactcgttaacttcagggtttggagtctcttctaattatct

gatgggttgatttaggcttgtttgagtagggagaggttgaaactgtagtg

ttgataggccttcaggaacggttgtaaaacactgcactagtgcattggcg

ttttgcacttgctccctttttgtttttcatattttgcttttttttttttg

tccgtatttttgtttgtcactcttaattataaacagaaatctttaggaac

ttcatgattcgaaaacggttcttaagctactttttcccctatttcctcag

ccatgcaaatgcatctttccaactttacatttcaaccagaattagagttt

ctatgctcattctttgtgataggaatcctattaatgttatatttttaact

tgtgtacaccgtcaagatttaatttgaatcagattctaatctgaacttca

gggaattgattcaacatcactagagagaagattgcacttaatatttagca

ccatattcatgacagtacaatgagcatgaaaaagacgatgtgtaagagct

catttttgtctagacattgttaaaaagaccaagatgtccagaaaataaat

agcattttttttactaaattaataaattttacttcaagaaatgcagttta

tgaaaatgacaccagggttgtgctacaactaattaaaatacaataaaata

ataaaataatcgttactgaaaagattttgttctaaataaataccttataa

ataaacttgctgaatgtaataataaataacgaaactaaaaacacagtaac

actaaaaaaattggccttaaacctgtttattacattttgaataaataata

aataaataaatttaattttttgattgtataactattatagttgtacttcc

tattctacctatttttgttgaattttgtggtaaaatggcatgttatgcag

cacaaatgcaacatttgtataatttttgcatcttttttaatggttcgctg

ttttaaacgtaacgcgagaaagtttacattaaaaaaaactttacattttc

tcctatctacatctaaaatgagttttgcacatttaatatgatgccgtgct

tgtatttatgcgtaatgttgcactgatcttatatgtgatttctcagtagg

actcaacattgtgttaatgtcagtgtctgtttgtgtgttttagGTGGGAA

CTCACATCCGCGCTAAGAGAAAGAGGGAAGAGCTCAGCAACACACTGGCC

GCCATGAGGAAAGCTGCTGCCAAGAAAGAGTAGCCTGTGTAATCATCAAA

AATAAAATTGTTTGTGTAAAAACGAGTATTTTTGACTCTTGTGCTTGATT

TAAATGTTTGCTGTTCATGTTGGAGCGTACAGAAGTGTGTTTGATCAAAT

ACAGGTTGCTGGAGTAAATATACGAGATGTGTGGCATCTAAACATTCATT

ATaaatttaaatataatgaataaactgctgtctctgaaaacgcttttacc

tgaaaaaaatactacaatattaataaacaaaaaacaattatttatgaata

tt