monopolar spindle 1

cDNA: Genbank NM_175042

 

hi1830 is in the 7th intron (uncertain how far past exon 7, as exons 2-7 are in a gap in genome assembly (v06))

 

gagacaggcaaatgcactgagcattcttatattaaacaatgtgttaactt

attcattaattaaaatcaattcaaagtgaaatacttattcaaataattat

atttaatcaaaataatgagaaacaagatgatgagaaaaggataaatgttg

attcatgctgagatggattggaaggtataaatccgaatccttcaatagag

cttagatcaagctcaaagaattaaacccgatcttactcgagtctgtgcac

cttgtgtcttagcccaacccatttcaacacattaactttaattataagct

cgagcttgatttaaacctgaatactctgccaaaaaatgcttttcttgctt

agatttttagtcttgtttctagtctaaatatctaaaatttcttatatcaa

gaagcattttctagacaagcaaaacatattgtcttgttttgagaaataat

acgccaatatgaagtgagtttttccttaaaacaagcaaaataatctgcca

atggggtaagcaaattaatcttgtctttttctttaaacgtaagaatagtt

gcttacccc

hi1830 (3-5)

attggcagattattttgcttgttttaaggaaaaactcacttaatattggc

gtattatttctcaaaacaaaacaatatgttcaaaacaaaaattcttcttg

atttaggaattttttagatatttggactagaaacaagacaaaaaaatcca

agtaagaaaagcattttttgcagtgtgtttttaatacgtgtgctgttata

acaaacgttctcagctgcaattttgagtcgtttgttttgaactacagaaa

ttactttggatttagcttaccttgctcttagggctatgcttgaagaagtg

acaacagaggacattaaaggctgaccaccatcctctctgtatacctatga

acccttcaattatgccgggataccattctaacccgctatcatcccgttta

agcattttccaatatctttttatgaaatgtgaaagtagcaccaaagagct

gatcttcaatgtgatctagtttaatcacaagacctgttcaagagaattat

gatttcgctttattttggcttgaaaccaattggcgaagatgagcgaaagt

agactcttagggatttgggtgtgtttttaaacagacaaatacacttgata

atatgtaaacgtgtccgtcctggcgtcttttatttaaaacactaataatt

ttgtcttaaatgagtgcaaacagtacgaaagtaatcaaatactttcatta

tggatttgactatagctctccatccaataaggctgattaagtcaggggtc

accaacatggtgcccacaggcaccaggtagcccacgaggattacatgagt

tgccgccctcaggcctgttctaaacatagctcagcattgcaccacatacc

agtaagctgagtctagtattttttgaagctattctttctaaatcacacct

gcattggtgtaaaatttgttaatgacattaaggtatatatataaatacta

aaactatttcagacaaacaaagtgttgcaaattgatatttctgtttctta

ccttgttaaatcattgttgagaactattgtgagaaatcattaacatgatc

agtgtcttcacatagatgaaaatcattaataattaataataacaacatat

gattaaaagtaaattgaaaaaattgttatttaggaagtgtgtatcaaaca

ggtagcccttcacaataattggtacccaagaagtagccctcagtttcaaa

atggttggtgacctctggattaagtaatgacaacaacaaaaaaaaaacaa

atgcttaatcacggcctgacctgaagatagtggcaggaaatgtcaggtca

agtctgggctcggacagagaatctaaactctacgataagagggggaaaaa

agtgtatttcttctgacttgtgttccttcttacagGCGGAAAGAGTTCCC

ATGGTGCCTCTGTCTATCCCTGAAAATGAGACCAGTGACTCTGACTGTGC

TCAGAAAGCAGAAGCTCCTTTTACCCACAGCAGCGgtttctccaggtcag

acatgtccatttctgtgctgtttattcataagtcagtattatgccacttc

aagtacagtgctcggcaaaaatgagtacacccccttttgaatattaatat

tctatccatttctcagtataattgtcacaatactggaattcgagaccaat

cagtgctgatattttaaaaacagccattttctgctaacatttgagcgctg

ttgagcacg