ornithine decarboxylase 1

cDNA: Genbank NM_131801              

 

hi1841b is in the 1st intron, before the ATG

 

gcgcgtcaccctggaaaccacgtcactatatatactgcagtgccgaagca

CCGGCTTTTACTCGGTCCGAGAATCAGCAGATCACACCAGCCCGTCGAGC

CAGGAGAAATACAGCATTTTTCATTTCCAGCACTCTGGTCTAATGGGAAC

ACTCTTTGTAAATGCGTTTTAAGgtgagtcgtgttatatttctgtgctaa

taatggcgtaattatgccagggtatactttgagt

hi1841b (5-3)

gtgatgtagtacaattttgtgaataatgaagaagctattcgctgtgtaag

tcgcggtaaatgtgtttaattgtgtaatctgtggcttgtttaagttgtgt

cgtatattacgacattttggcctctgctgtgtgagtcaacgtggccgatg

tgtcacactttccttctcttatttcctaaattagatatttttaaatcttt

acatgtgttgatagttacggttatgctaaaatattcaatatatatttatg

ttgcatagaatttcctaacggtttctcttaacatcaatgaatgaagtcag

catggagaagttacacgctgcagacagactagcctgaataagtgccttct

attggctgagcttaaagaaggacttgcttgtgattggttgacagggttgc

ctgttatagtccgtgcaaataggggtttccttattgggtaaccggcatat

tcttgggaggagggacttatttaaccggctttctgtgaaaaatgtgactg

aggatatgcgtgtgcgcggtttaccacagctactaaattaaatactaatt

tcacgcataattcgccgttacagcacgcattttgacctaaatatttatca

aatgaaaacttcatgcgtaaattgacttctcagaacacactttaataccg

caatggctgaaaagttcaacttgataatactttccttgtggtttttaatg

ctttcagAATTCTTGCTTGAGAGAAGTACACACCGGCCCTGGCCTTGAGG

CTTATCTGAAAGGTTTCAACTTCACTGGTGAACCTCCTTGGCTGTCTGAC

ATCTGTTAGCCACGTTTCAATCCCATCTCTTCCATTCGTCTGgtgagtca

cagtcctgacttttgggagcatcccgtgacgtcagagaacaacttaat

 

approx 1.8 kb to first coding exon