polo-like kinase

cDNA: Genbank AY648752

 

hi1856 is in the 1st intron

 

ACTGCATTCCCAACCGAGCTGCGGGCCGACGCGCTTCACCACCGCCCGTT

TACATCCACGAAATTCGACAAATGCGGTGAATATACGGCGTTTAGATACT

TTGTTGTGCCTTTTTGTCTTGGCTGGCGGTATTATTTGAATGCGGATTTC

AGCGGAGGAGTGAAGTACTGCGTGTTGTTTACGGATAAAGGAGCAGGAAA

CATCGCCTCGGTTGTTTATTTTTCAGGACGTTAGGGTGTATTTTTGTACT

TAAGAGCATTTGTAGTGTACAACGATGAGTGCTGCAATTGCAAAGCCATC

GGCGAAGCCATCGGCTCACGTCGATCCCAAATCTGCTCCTCTGAAAGAGA

TTCCCGACGTTCTGGTGGATCCGAGAACCATGAAGAGATACATGAGAGGT

CGCTTTTTGGGAAAAGGAGGATTCGCCAAATGCTACGAAATCACAGATAT

GGACACAAAAGAGGTCTTCGCTGGGAAAGTTGTGCCGAAGTCGATGCTGC

TGAAGCCGCACCAGAAGGAGAAAATGAGCACAGAAATCGCCATTCACAAA

AGTCTCGATAATCCGCATGTTGTGGGCTTTCACGGGTTCTTTGAGGATGA

TGACTTCGTGTATGTGGTGCTGGAAATCTGTCGCAGAAGGgtaagagctg

ggaaagcattttgaaaacagaccgtcaacggtcggtattcctgtcactgc

ctcgtagtatcttgcaaagctcgacgtttaactcgtttaaattgcattct

gttaggatgaacaactacccattgtgatctttttaaaaatgttaattatt

tatttaaacgaggcacatataaagtgatttaactccactttcccctgtac

actgcaagtggattttaaactggaggaagtgacgtcggttgacttcgtat

ctcggacaaattgttgttcaaacgaactgcgtctaaacgtcgcttttgtc

gtcaaattttagtgtaatgcggattttaacatttaaaccctcaccaaaac

aattatttaattgttgtaaacttatcgcaaccatgtatttggcgtattgt

taacgttaacattttatccagtttcactaaacgtaacgttactgtgattg

tgtacagtacaaccataaaaacatgtttattgaacttgattattt

hi1856 (3-5)

gtaaattgtgagccctcgtatagttgtagtaagtaaaattattattcgtt

ttgggaaactaaatcctttaagagagaaattgttttattctacaagagac

ccgttacgttaaataattaaattttatcattttaaatccttttcacaggg

tgtcttaaattacaaactaaattttggaccttaaaagtctcaaatttgct

aatttatggtcttgttggtcttaaatttttaattgttcttaagtttccta

tgcccatttaaagttaaccacatgggcaaagacctacccaatcagcagca

acagaactctataaaacgtttaactaaatataataactatttacctatat

ggttttattttcctttgcgtaaaatttatttattttaaggcttcttagca

ttaagcccatttgtgagtctgaaatttcgtttataatggtcttaagagtc

ttagatttgacgagacctgcagagaccctgtattcagtattacaatatgg

tctattccttttattttttttataaattagtttttgtttgttttctgctg

ttaacttttttcccccctcttccagTCTCTCCTTGAATTGCACAAAAGGA

GGAAGGCAGTGACTGAGCCTGAGGCCCGATACTTCATGCGCCAGACTATT

CAGGGTGTTCAGTACTTGCACAACAACAGAGTCATTCACCGTGATCTCAA

ACTTGGGAATATGTTCCTCAATGATGACATGGATGTGAAGATCGgtaagc

acacacagatttttacaatttttatacctgactttttatatatacttaaa

attaaggctatttgttctcctctttgtagGTGACTTTGGTTTAGCCACTA

AGATTGAGTTTGATGGGGAGCGAAAGAAGACCCTTTGTGGCACTCCAAAC

TACATTGCTCCTGAGGTGCTCTGCAAGAAAGGCCACAGCTTTGAAGTTGA

CATTTGGTCACTAGGATGCATTCTgtgagtaccttgttgaattaattgca

caatgatgttttcacaatgttatgttctctgatggtgtttcattcttgct

aaagctttaattttgtttaacatgtactgtactcgcagt