coiled-coil domain containing 49 (pate)

cDNA: Genbank AY648753

 

hi1858a is in the 1st intron

 

GGTTGCTTCTGGATATCCCAATACTGATCATTTTCCTCCCAAACCCCACT

GGAGTTTTTCAGTTTTTTATTATGTGGCTTAAAAAAGGGCAGCACATACT

AGTCGTCAACAAGACTTTTATTTTACAACTGCGTTAAACCGGAAAAACGT

CCTTGCTTCGTTCCACAACAAACATGGAAGTTTAAACGCACATCATCAAG

ATTGCGTGTTTAAATATATATTAAAACCTTGCGTCATTGTTAGTACAGTG

TCGATAACATGGGAGGTGGTGACCTTgtaagtattttttgtctatagtgc

tgttgctaatgttaaccattgtggtttacctgtagttagcttgtttatgt

cacgtaccagtgtcaataattgaccgtaattgaaaataaacgtttatcaa

taacttgtaat

hi1858a (5-3)

tattataatttattaaaaaatatctactcacagcgtatggatactaatta

 

approx 2.4 kb to next exon