capping protein (actin filament) muscle Z-line, beta

cDNA: Genbank BC055514

 

hi1858b is in the 1st intron

 

GAAGCGCTGACAGGGCAGGGTTGTTCCGTCTGAGAGCTATTCAAGCGTCC

AGAAACACCCCAAAAAACACACCGGACGACCCACACCGAGCCTCCAGTCC

CGCACGCACCGACACCGAGCGCCGCAGACATGgtaagagccgccgctatc

gagcccgggctccggtgaatgcccgttttaggaaaagagccgcggagcct

ccctgaaactgagccgcgacggagcccactatagaacacacacacacaca

cacacacacacacacccaaaacacacacacttgtcacactctgcacgaga

aatatcgccaacagagcccctctttaaaccgtcttttggggtggattagt

gtttgttttggtgttaataatgtagttattgtggtacacattcgagtatt

gtag

hi1858b (3-5)

agaaatgttggtgtttattttcctttataggagtgaatgtgtggtgttta

tatgtgtggtgtttgagtttagctgtcagaggagtttagtgttgttttct

gtattgagttctagcagtgttcagtgtttcagatggtggtgtttatcttt

ggtttggttttatggatgtttagtggtttcatgtttaaaatgttgatatt

cttatgagtttagcggtcagatgagttttagagatagtttgtgtgctttt

gttgctatttatggtagttctgattctttgctatcttaagttttagtcag

tcttttgcggtgattggtgtctgttttggtgttaataatctagttattgt

ggtgaatattcaagtattttagagaaatgttagtgtttattttcttttac

aggagtgaatgtttggtgtttataatagtggtgtttgagtttagctgtca

gatgagtttaatgttgttttctgtattgagttctaatggtgttcaatg

 

uncertain how far to next exon