coatomer protein complex, subunit alpha

cDNA: Genbank AY648754

 

hi1872 is in the 5' UTR

hi2203 and hi3669 are both in the 1st intron

 

tttttacccaattatttaagtaaatggacttatttttgttatctttgttg

tgccaaatgatataattatgtggggaaaaattgtgcttgtggataaagga

tgacgaagcctctgtgacgtggagcttgcgatgctggcatttgaatcgta

aaaactttatttgctcgcgcacgagagcaagccaaggcccgtgttgagtg

gattgagtagacgtgtcagctacggaagtggagctgcaGAATCAAACACG

CAAAGTCCCTTCCTACCGG

hi1872 (5-3)

GGGATGATTTTAGGCTTCTAATTCGCATAAACGGATCAATATCTTCACAC

ATAACACATTCCTGTTAATTTTACATTATCAGTGGAGATGTTGACCAAAT

TTGAGACAAAGTCGGCCCGAGTGAAAGgtatgatatccgctcttgcttgc

tagcttcactttactcctgtgtggtgtatttcttgaggcctattgttttg

taaattttcaaattttatat

hi2203 (5-3)

tcttaatgtgtgtaggatataatctggtgtttttttcagcaatgatttgg

tttagaacattttgaac

hi3669 (3-5)

actgtatggcattcagcgttagcaaagcgctaactttagttagccgtcca

gacgccgcagtagagattttcatctctcgttttagtcatgacaataattt

gccaagactgtcattttaaataaagaatagatgataatgataataataag

gtttaaagaatgtaatcatgattctctccgaatacactgttcatttggct

gtctttataagataaggcacaggtgaatcgattacattaagaattgctaa

catatttttagttttgtaataatgtttattgaggtgaacttggttttata

ttcgcacatttgttcatttttgaacagtgacaacaatcttttaaaacctt

tgactaatcagcatgaaattaggttgaaatatgacttcaatacagcatta

gctctatttaactgactatgaacgatgttgtactttgatagtcattggct

gctaatgtgatttcactatttagaatctgcaaagaatactttttctgaaa

ttatatgattaagaagaaagtgcatatgtgtgaatataaaaccaacttta

ccaatataatatgtttattaaaactagagctgcacaatatatattttata

tataatgtttgtttccaaattgctttgtttgcatttttcttctaaatgtt

tttatctgtttaagcaataattttctctaaaactgcttctgaccgtgact

tgtccacactaaatagtatgagacatgtttgagggattatatgcgacatc

cttcatttgttctctaagaaaaggagagatctccacttaagtatcgtact

ttaagggaaaatgtgctgtatgtaacgttaaagttatttaaagcttgaag

cattgaaatgtatcagccaattaccatgaagaggaatcggtgctcagtat

ctgctccaaaaatcctgatcagagtatccctattattaattatatataat

tttctgtgtataattttttacaaagctgtgtttttctatcactgcgtaat

tttaataattattgtgaaaagccaggaagttattattattttgtttgtaa

aggggacacgtatggctcggtgcaggagagaaaatgccatttataaacgt

atgaacagatgcgaaataacaaacttaaaattgatcttgtgttttttctt

ccactagactaaaaaaatttatcatgaaaagtcaaaaaatttgtctctta

cattaatgaaaacattgtcatcttctacagGGCTGAGTTTCCATCCAAAG

CGGCCCTGGATACTCGCTAGTTTGCACAATGGTGTCATCCAGCTGTGGGA

TTATCGCATGTGCACTCTAATCGACAAGTTTGATGAACACGATGgtatga

aatagctgatcaatagctatgattcatagtca