replication factor C (activator 1) 5

cDNA: Genbank AY648755

 

hi1877 is in the 1st intron

 

acacacacacacacacacacacacacacatacacattattgaactaaaac

catggtcagtccatgtaagaaattacagcagtaaagattttgcagcagta

acaaagacagatagacaaaatattaattgaataaatattaaactaattag

ttaaataatcacttcctcaaatataatgagttacctttattttatgattg

gcttcatttgtaatgactcttaattaattgataattaatcgatacttaat

aaattaattatatttctcttctcagacaaactgaaattacgttacacatg

ggtatgataaaccaaagttaattcgaaaatccccaaaacgctgaaaaagc

tttatgtacaatataattttgtgtgaaactctcggttacttaccaaacca

ccgtaggcacagcagaaaaccaatgactttaattatctcttcttaaactc

ttattatgaaaacacagcaatgtggttcctcgctaatcccgccttcacta

acaagcgctctttcgattggtcaaaaatctgttggctggtgacgttcacg

gacggaaatgtgcgtgtagtcagaaaaacgcgccaaggcacatcGCGCGG

AGGATTGACCAAAATATAAGAACTCATGGCGTCAACAAGTAAAACACAAC

CTCAAGCGAGAAATTTACCATGgtaactttatttcttcttcttgtagaat

gaattacaatattaagttgtcagcagataatagaaataagaggcgttttt

atttactcgacgtacaacattgcagttttgctttgtttacatgtgcactt

aatcatcctatatgataatgtgaatttattaatattaaaacaagcatgga

atagagcctagttcgttatgcaatatgtacgacaatggattcgagtttat

tagagcgatcatacaatagcaatggtgtgtatttataattatcgtgacat

ttgtcattgctgaagaaaatccatgactaacgttaatcgtcaaggaaatc

tgtcagttccttacgaaaaagtccttatgtctgaacaataataataactt

tttattaatattatgcacttttgctggtagcttttataataatatcagga

tgttaatatgtg

approx hi1877 (3-5)

gtagtttgtaagcttgttttaaaaggtaaataatgtttgaaaatgttagt

gtgatggaaaattttaatattaatcatcacatattgattttataaattga

ttaaggttttgttaaagttaagatcaaatgctttataatcattgggctat

attaaagattgaggtaaagttggttttatatttacacattcacactttct

tcttaatgatatcacaaaacaaagtattctttgcaaactcttaatatttc

aattaaattagcagccaatgactatcaaagtacatcattgttcacagtca

aatacattgtactaatgttgttttgaagtcatacttgcatgtgatttcag

actgaatattcaaagtaccatggtaaacgagcatgtcacaagttgtcact

gaacgagtgtgcaaatataaaaccaactctacctcagtctattttagcca

tgtgtaatctactgttttttaagagttaaggagctgtagagaagttctta

tctaaaacattgtaacattgtctttaaaaacgcatgtaagcccatgcttg

ggatccttttgctcacagatgctgtctgtgtgtaaactgaccattgtctg

gagaattaaagcaattaaaagacaaactttgtctaactttattcaagttc

agtcttcacatttaaatgtattctttgtgaacaggaagaaaatcaaacat

gcatgatatattaaacattgtgaattgtttctgttcaaaatatagtttgt

atgtgtgaatatatgttgaaatgtcatttattttaagagtcatttttatt

atttttattattattattattatttattatttttttattttccagtgtca

cgttgctgctctaatatgatcagtagttattgatgctcagtcattaattg

tgcttctttatattaagtattttaaaaatatagaacaattctgcttattt

ttttgtgttgtacattttaggttatggtaaattatttaaatacaggattt

attatcaatgataaattattactcagaaattattatgtttacaggatttt

ttggttcatttaaaacgtatcacttcattaatcctaaggaacacaaaaaa

cacaacataaaaactgctaaatgtttttaaaatgctttttcttttttcag

GGTTGAAAAGTACAGACCACAGACGTTAGACGACCTCATCTCTCACCAAG

ACATCCTGAGCACAAgtaagcagcaagaaaagtggcattatggcagccat

tttaagcatggtgttgtcatttgatttttgtgcttttatttttcactgtt

aataatggcatagcttgatccaggcaaaactttaataccgggcttttcgc

ttacagttacccagttgg