dihydrolipoamide S-succinyltransferase

cDNA: Genbank BC045500

 

hi1903c is in the 1st intron

 

aatttaaatgtttaaatgtcacggtgcacagaatgacagctcaatggcac

gttccattcatgctccccccgctccacctcatgatggtaggttccgcttt

gcttccgacgtgtgctcgcgctGTTTCCGCTGCTGTGCCGTGAGAGCTGC

AGTGCGCGCGGTTCACCGACGACATGTTGTGTCATTCCCGCTGTCTGAGC

CGGAGCCTCGGCCGCTCGATCACCGCCCTGAGACAGgtacgtgtgtgcgg

gagcgccgcgctcctcgaagagacgtgacgggacagggagcgcgcgcggt

aacggcattggtaggccgcgcgcgggcccaagggcagcaggacacacacc

aagcaacacataaacacactcgagcaacagagtattcacacacacataaa

cacacacacatgacggacacaccggcgctccgtgtgctacatgaggtgtt

tgacacgcggtaaagccgcactggacaccggcgagaggtcacagaggagc

ggctgctgtcagagcgaccatccggctgggcggctgctgctttacgggat

acagctgcggccggtagttaaagagtgatatttataatatttaataaatt

ctccattaaatgtattttattaacgtctacccttagtccaaaacctgaac

ccaagcctcacagtgatgtaaaacagtcgttataccgagtattagtcata

ttatttattaaatg

hi1903c (5-3)

atccgttaattgtattttattaatgtctaagttaccccaattctaaaccc

aatcatcacagtaatgtgaaaacagcaattataactaatattatttatta

ttttatccataaatcgtgttttaataatgtcaaccccaactctaaaccca

gctctcacagtaatgtaaatattcattattgttgtacagggtatcagctt

ttgtatcccttctaaagtttaactggtgatcggtcctgtgtgaaaacgcg

cacactacatttacatgagttctgacttgtgtaatgactgtgtgtttgct

cggtttgtattcctcttgcgcgttctcatgcttttaatggtttgggtgaa

gttggttttatattcacacattcagactttcaccttcttgatatgattcc

agaaaaggattgtttgcaaattctaaatcatattagcagccgatgactat

cactaacattgtttacattcaatgaaatagtgctaatgttgttttgaagt

cacgcattcagtttcagacttaatatttaaagacattttttagtgcttcc

aatttaatttgatagatagatagatagatagatagatagatagatagata

gatagatagatagatagatagatagatagacagacagatattagagctat

aatgggaaaaatatacaatatattaatgtattgtgataacgatatttctt

acaatataatatttccgtatagaaaaatgctatttttattagctatgttt

ttaaaatcattcatttatataattattttaacatcaaaacatttaattaa

cgctaattcacaccaaaaaactcaaatatttcgcctttagagcattatga

atgattgaaatcctgcagcacatgtcctgactctgattggctgttggcat

cttcttctgtcatctcgactccgcctattattttcaccgttgggttcagc

tccagccaatagcagaacagcaattcctgaggaggtggggctaaagataa

gaacccatctggttggtcagatttagataaacaaccaatgcataaaataa

aggtgatttatcacacttatattgtgtatactatttttgcgctaacgata

cttttgcgatatatcgtgcagcccttataaatcttgtctatttagctgct

gtaagagtagatcagggaacggctcatgtttaagtgcatgaggagcaaag

gctgaacagttcattcgtctgtatgtcaaagtcctcagctgtagtattgg

tgtgtgttgaccctgcagcacgtgtgaatctctgacatggagcacataga

tggatcatgtggcgcagatatttcagtcaccttcaggaatggcctgtggc

tgtgtttgaagctttgccattacatgctgatgtgcgttagggtttttgtt

ttgaacttatttattttttcttctggttttggggtcaggacttggcatgg

gacgatagccgttttctaggcacatcacgatttggaaaagtcaaggttat

aataccaccaaaattttctgtaataccgttctaaagctttgtctaagatt

ttttatttacatttttttgtttgttttttacgacaacagtatctccagca

gaaaaaaatccaaaacttagttaaagaaatcagtgtttttgaaacaaatg

aagacagcagaagtcaatgattcattttaattatttagactgacgtgttt

actgctccaaactattataaatctttcaaaaaatacaatatattgttttc

aaaaggaaataaaagctcttgttttttacccagacatttaaaaaataaat

atttcagagcagtgatcacaataccgtggtagggtgaaaccgggatattt

ttatccaaggctatcagaatcttacactggcccatgcctacccaaaacgg

acttctttatggctggatttagtcgaaattatgggtgtcaaaattaatat

tttcttcggtgcaccgctatgcagacgcggacaattcggtatcggttcag

taataatcataaccgtttaatatgcactgacgtcattaattgttgtgctg

tttgtgaagattatcaggttgaacgttggccctgatgtttgtgttctcat

tcagtcagtgcttataggctgatcagtgctgttattttgatcgttgagga

tgcattaatgtcttcatcttcctctttcagGGTAACAGTGTTCTCGCAAG

ACGGGCTACATCAGgtgagctgagagactctgtcaactgcactacatcct

aacctgcacactgtaacaccatagtcacaatggtaacactttagtcaca