polymerase (RNA) III (DNA directed) polypeptide F

cDNA: Genbank AY648756

 

hi1942 is in the 5' UTR

hi3290b is in the 1st intron

 

tttttttttaggaaaagaaatttatacagtgtgttgttaactgtagagct

aaaaaatgaagtagaaaaaaaccctgcaatgtctgaaagagatcagccag

cctcacataggtcaaaaaagtaaaacaaaagtaacataatgcattaccta

ctataaaaagtaactaagtaatgtaacaagttacttttttgggaagtaac

tcaatactttaaagcattactttctgaagtaactttctccagcactggtc

ctctttaaatcatgaggatattttagtcacagatatactcccgtacagta

ggtggcggtgtaaatcttttgtctagatttgagctttcagtttctgttgc

catatccgtgttttatcaacgaatgtaaaatacttccgttataaatacta

aaagtcgtgtcttaactccgaAATATAATTGGGTTTGACAAAACAAAATG

CTTAATTCTCCGTTAAAAAGAGACAAGCCACCGATGTAGTCATCCTATTT

GACAGCAGTCGGCTGGGTTATT

hi1942 (3-5)

TTTCGCTGTCTGGCAACCCAGTCGCCTGTAAACTCTCCCCGCCTCTCGCA

CACTGCATTACCACACGGCGTTTCATCTTAGCTTTAAATGGGTCTATGAA

TGTATTGTTTTGTTGACACTAGGTCTAATACTCCAGTAACTCCAGTCTGA

TGCACAATGACAGAAGTTAAAGTCAAAAAAGAGTCAACAGACCCTGTAGA

TATCGAGAATAGgtgagttgagcgcagttacactattcttgcgcatgcgg

cctgttgacgttaacaaaacaccgtaggacaacgtgtacatagatttaaa

aaagcaattaaagtttccatcaaatctattgtctcttttttgccacgtgt

acacgtttagataccgaaaagtctgacaacatgaagc

hi3290b (3-5)

aaaatctctttct

tagtaacttaaagagcttcgttgtatttcatgtaccttttgaatgacgaa

gttttaatagtgtatgagtttgtaaacaacctctttattagtattatttt

aagatgaagaacaatacattgcatttctgtatgtctatttcatgcgatat

gttgattggccttgaagtacgagttcagaattacgtcagcaaaatgcatt

ttaagtatttttgttgttaaaataaatgtgtatcctttacatgttcatcc

tttccacagacaatacgtttttgtttgttagatagtgtttcctgtcttgc

agcacagaggatgctgggaaatgtagttgtttgctgatgcttgctgtgtt

ttcctcttctgtcatagGATAAAAGAGTTGTGTCAGCAGTTTCCACATGG

GATCACAGACCAGGTCATCCAGAATGACATGCCTCATGTTGAGGCGCAGC

AGCGAGCCACGGCCATCAATAGACTGCTGTCTGTGgtgagatgttcagct

ccatcttactgtaacagaatgaaacgtgcgttcctgcactttatatttat

gtctgattgttcttttctgtcctcagGGTCAATTAGACTTGCTCAGAAAC

AGCAGCGGGCTTTTATACAGGCTTAAAGATACCCAGTCTGCAAGgtttgt

gtgtcaacattcacacacaacactcagatttttttagtttatagtaatta

atgtataaatgaaaagaatatgaagttcacacacacaaaacatatataca

catgcaagtttagtgagcaaaaactaatttgaataaatacatacatatac

atgcacagacattcatgatcaaatcaattcgttgcaataaaggcaataca

tgtcatatgtgcgtacaaatttaggacatttatgtaagttcagatttatt

aaaattatcttctcgaagttcatgcaaatttgcacattaaaaaaatgatt

tagtattagtaaatgtaaaataaataaatctataattaattgcatttctt

tgtttatttctatgtttattttgacagCAAGGTAAAAGGCTCTGATAACC

AAGAGAAACTAGTGTGCCAGATCATAGAAGATGCTGGAAATAAAGgtaaa

atgcttatttatcatcagggcccgacggaatctgcggaagtttttttttc

agtctctacaaactgcattgtgcataaatcagatgaacattttcatatta

gtcaataatatttctgtaattaattacaaaaactcaataagtatagattt

acacacatatacccaagtaaataaacagaattaatgatgggctaaaaatc

tgcggaatttcgactcgcgcc