splicing factor 3a, subunit 3 (splicesome-associated factor 61)

cDNA: Genbank AY648757

 

hi1950 is in the 1st intron

 

ATCGCGCGTTCTTGTTTCTATCCGAGTTAAATAAACGCTGAACCGGTTTC

CTGTGCGTTACACGCGCGTATGCAGGTTAAACTAAACATTGTTTGAATAA

TCAACGTATCTTAAGGTAATAAAACACAATGGAAACGATTTTAGAGCAAC

AACGTCGATACCATGAGGAGAAAGAGAGGCTCATGGACGCTAAAACAAAG

GAGATGCTGACGAAAAAAACAACGgtaacttgagttaaaacgatgctaac

gctataacagcattacccataatgcacatacaaacctagtatatttaact

caatacgaactttgttaaaaagtaatagtt

hi1950 (3-5)

aagatgggaaaatatttttataatcgacgaatttatttacgttgcattgt

tggtttcatagtccgctatagtcctcttttttactaacgttaatgtagat

tggtaacgttagcgttacagatgtgtattaaaccagatttcctagtttgt

ttcttactataaaggttgtattattttaaagctttattgttcaaattatt

tggatgatttgtatatctgacgattgactaattttatttgatatctttta

tttttattaattttgacagtttacttttaagcgtgacgtcgttaagttta

catcaagtcatttgcgtgaactaacgttaatgttctttttcacggcacga

gtttcacagtgaaatacagtatttccattaataactaggttttattgctg

taattatttaacgtaacagttatacaaaataaggaacattcactttttta

acatagcttgccttgaaatatgttttattcgcattggaattataactgct

gtatattttctttgtacactctgctcattcaaagtttggttggaatcact

gctatttgtctatttaacgctttactttttcaacagCTGAGAGACCAGAT

CAACTCAGATCACAGAGTGAGAGCCATGCTGGATgtaagtttcctttgtt

ccgtttcatttgttcattaatgtctttggtttcctataaagcactacttg

tttatttagcaaaaagttttttttgacaattataaacgcttggcactatt

ttgagatgtccttgttgtagtgtaaccaatcagttattaacattcagtta

ttacatttgtttttattagtgcaacttttgaaatgttgctatcaacatag

tcttagttgctgacaagacaaaacaaataaacaaactacagattaactaa

aaacagttctctaaaatgcaattgaaatgttttgtaaagaaaactttgtc

acatttgtgttaattcatacagAGATACATGGAAGTGAGTGCAAACCTCA

GAGACTTGTATGAAGACAAAGATGGgtaaggcagtcttgatgatatttga

gtctttattaaaatatatcagcattatttattgattgattgattgtgtct

gatcagTATGAGGAAGGATGAGCTGAATGCAATATCAGGACCAAACGAGT

TTGCAGAATTCTACAATCGACTCAAGCTAATCAAGGAATTTCACAGAAAG

CATCCTAATGAGgtagacaaagggatctttcttttactgtcatttctgtt

ttgtcgttcgaaatactcagtctttgttgtgtcaatttcagatct