RAE1 RNA export 1 homolog

cDNA: Genbank NM_200998

 

hi1951 is in the 1st intron, before the ATG

 

aaaaaaggctggaactgactgtgacgtcatcaaaacacgtacttgcttag

cgctgactgagcgacggaagtgcatactttttatCAGAGTGTCGTTTCCT

GAAGCGGGAACCTGTTATATGGGAATAATCAAATATTTGCACGGCTGTTA

CCTGAgtaagtttagctgaataagatgttttaactgaccattaccattaa

tggataggttgcagggaaataaccttacattaaactgtaacgataacgtt

acttgctgaagcctcttaaaatctatcatcacagtgtggttttacgcatg

taaacctggcgtataaagaattgtttcgtttctgtaaccagataatcaaa

cagaatagagcgctttcaaaaacggggctgtttgttaatgctatctaacg

ttaccaccattaacgttcttctgttaacgttaagtccgtattgctggtga

aaccacttaacgttaccattgttgcgtgccagtgtcataatgtttgctac

attcagatgatatgaatgtgt

hi1951 (5-3)

tttatttagACTAAAATGAGTTTGTTTGGGACAAACACGGGCTTTGGGTC

TGGAGGGACCGGTGTATTTGGCAGTACCACCACAGACAGCCATAATCCAA

TGAAGgtaaatacagaaatgttatgtctgtcaaaatttagatatgtgaat

gggaagtaatatgaggtgtcgttgataacagGATGTTGAAGTAACTTCGC

CACCCGATGATAGCATAAGCTGCTTGGCATTTAGTCCTCCTACGATGCCT

GGGAACTTTCTCATCGGAGGCTCGTGGGCCAATGACgtaagtcgttatcg

tagctgcattttgtgtcagcgtctctgtattttttttttacaacctcaac

tgggatattcactatggttaatatgtttttacatgttaaaatgttttcat

ttcaaatacatttcgaatgattggatcttaaagtagggttaaaaatcttg

ctgtcagtttgtaactgctacattctgaattgttttgttcagGTACGGTG

TTGGGAAGTGCAAGATAATGGTCAGACTGTCCCTAAAGCCCAACAGATGC

ACACTGGCCCAGTACTGGATGTGTGCTGGAGTGATgtaagattataattt

taaatattagttatcttaaaagtgcacagatgacttgttaaaatttaaat

gttaagtaggtaaagtatttgcacaggaatcaaaattaaaatcatgaaaa

catgttcactgataaataaaaaccagcactgacttattttgctggttaaa

cagattaaacattgcacttgcatagaaccctgtaatgtacactaaataaa

agccacaatatgatttttgcgcaaaatataatcgtcttaaaatctctaat

tttcactcctacttatttggtatgtttatggttagtgtgagttgttttgg

tttgtgatttcttaaactgaaaagaggtgtttacagatgaataactgaat

aactactaggtactgaaattttacaccctcttatctgcttttgtgttttg

catgaaaagGATGGTAGTAAAGTCTTTACAGCTTCTTGTGATAAAACTGC

CAAGATGTGGGATCTGAACAGCAATCAGGCCATTCAGATAGCTCAAgtaa

ggagtttgtgttcattttatgtttttgtgcttatgaattgacctaattaa

agcttttttttatagcaaaacctgtactttttgtgtgtaatttaataggt

tctacaatttttttttcagCATGAAGGTCCAATCAGGACAATTCACTGGA

TTAAAGCACCAAACTACAGCTGTATTATGACTGGCAGTTGGGACAAAACT

TTGAAGgtgctggaactcctcctcattagattaagacagcaatcatggtc

atgagatgacctaatgacctaacagcaattctattgtagccttagtctag

agtaggttaacaactgtttctgtaatatcataattgtttatttttcttga

cagTTTTGGGATACACGTTCCCCAAACCCAATGATGTCCCTCCAGATGCC

AGAGAGGTGTTATTGTGCCGATGTGgtaaattaatttattattatttttt

ttattgttgaattcatttgcctagtttggataattacttagtttagtgtg

tgtacttgttaagaaaattacatctcttccttattatctgtactgtgaca

ttgtccttaggcagtacatgatatctaaaatatttttttctgaaatttga

tttgtatttttgtttttggattgtattttctaggtatatcccatgg