40S ribosomal protein S8

cDNA: Genbank AY561509

 

hi1974 is in the 2nd intron

 

atatatatacacactatagtaactaaatgaatgactgtttctgcaaaaca

ctggaagggctcgttgtggcagtcccatgtacttccactgactgaactgc

tctcgcgagtcgcgacttcagcaggtattctcgcgatatgtgtttgcttg

aaacccgcccatgagcctctgcgagccCTCTTTCTAGCCGGCGCCTGAGA

ATGGgtatgtgtcttccgattctgatcgctggaacaatccgtcttcatct

tctctatccgacgaggtttatagttaatctgactttattttgtattacag

aagtaatatttaaaagatttaggtgaaaatcgcatgatatagtgtatttt

aaaacagtttgcgtaaataaactgtaaagtggctggatacgttgctcaag

atggctgcgcgcatgcgagagtacactttcacagcgtgtagagaacagac

gaagctgtagttacagggacgagtacaaggcaagctgtaaatataaaagt

actgtgtatgtaagtaacattgctgtaaaaaaatattgtgttttagaggt

gtagtgtatgggaagtagttagcacagctaactaagctaaacgagtgaga

tgcatgtcaacttacgacgctgcatggccagctaacgtgacccgagaact

ggatttatgtagtttgtaaacgttaaattaacattcactttatatttctt

gtcataaatgcgattgcaacactatctgttcgctaatggtggaagcgtgt

aatggcaagagttcacgtcgtgttagcttgttgctaacgttaaatgaatc

agtttgctgatttgtaagtctttgcttttaaagtaacgattcgtccaaac

tcaatcttaagtttaaaatgcagtttttttctctctttgaagttcgaaaa

tagtatttttttttaatggttttttcttttagagtcatcggcttgacacg

atgagtggagttatttttgtgggttgataataaagcttgagtgtacatga

tgaatccaaattgcggaatccgattttccatgcggataaacaccttggag

aactgaacgctcaagcatttattgagtttacgttctactcgcattcatat

ttgtttactaagtctaacgcatttcaatctctacaccacagGTATCTCAA

GGGATAACTGGCACAAACGCCGCAGGACCGGTGGCAAACGCAAGCCCGTC

CACAAGAAAAGGAAGTATGAGCTCGGGCGTCCTGCAGCAAACACCAAGgt

gaaacactcttcagtgtacttttccat

hi1974 (5-3)

cagtatgggaaatgataatgtgggtgatgttaacatgtccttaggttggt

cttatttggccgtcttggtcaaagtctttgaccttccaatgttaggattc

gtcatagttacactgacacatggctgaacccacatggtctcttcatacgt

ctttgttgtatgtctaaaggtatgttttggctcctctctttagATTGGAC

CTCGCCGCATCCACACAATAAGAGTCCGTGGTGGAAACAAGAAATACCGT

GCCTTGAGGCTCGATGTGGGAAACTTCTCATGGGGGTCAGAATgtaagtt

tgtatttgttagtgctggcaatttacgtgtagtgggtttctgcaggtttt

aacaattactcaaagttaagttaggattttttttacattttcattggaaa

ttactttggattcatacttgaagtatttggtttttgaaagtgacattata

gaaactgtaaaggcatcagagaactcttatattgaggaaagttatgtaat

tcaccatta