60S ribosomal protein L19

cDNA: Genbank AY648758                

 

hi1987 is in the 1st intron

 

aatataacagaactctttaaagtgctaaacatataataaacacgtgcaag

tattacatataaagtcgttattatattcatattgtctgtgtgatagtccc

cccaccccttatgaatacggcggcacagtcctgaaatcttcctcattgac

aGCGGCTGCTGCTTTCCGCTGACCACCAGCCATGAGgtgcgttcctttac

gcgagttaaaatctatttatcttattaatttaactcgaggagtcgtttta

aacataatatctaagtatttatgtagtcgacactccttgcgctgttaaaa

acaaaggcgattcaacgcttgaagagcgtttgtaatgtagcgctgctgca

tgagtatcgtcgccatgttgtggcaaaagcaaacgtgtcgttt

hi1987 (3-5)

caacgataaaactgtattacgatgtgttgaataaaaaatgttatggtaat

ccgttcgaagtttaccattgtatcgtactaatgttttatttctgattatc

taatacgacaaacaaaggttgcgtggagtgttcggcctaaacagcccggc

caacaaaacgtgctcaacatgtctagacatgccccttaaccagaatagat

tcatttcgacgttttgcgtatttttaaagcaagtcaagctagtaattagc

aactatatagggtcatttttgtatattttgcttggtttgagcaaaatggc

aggcctattttatattgtagatgagttattctgcgcgtgcgcacaattta

tgaaacacgttatcaggtttatagagaatgtagcgacgcctcatctagcg

caaaaaatatagttttaaagtaattaaataaatatacaaataggttaact

tggcttataaagctgtacattaaatcatttgtttatattaaatcaagaaa

cacttcagataatgatagtgtttagtgttctgagaattaaagctaataaa

ttaagcttaacatgtcagtggggtataaagttctagttggatgtggatct

attggcaaatgtttaatcttgttaatttactttttaatcaactgcacagg

aaatgaaaatcagaaatttacagttggattttaagtatgggagtgttgct

aataattcaatctaaatttgaagagtgctgtttttgtactataatgtaat

tttgcctgacctggtcttgatgtagcctttatagaaacggcacccgctgt

gtgtgttgtacagaaaatatattgatctaaaattgtcttttttttttttt

ctttttttttgttacagTATGCTCAGACTTCAGAAGAGGCTGGCCTCCAG

CGTCTTGCGCTGTGGCAAGAAGAAAGTGTGGCTGGACCCAAACGAAACCA

ACGAAATTGCCAATGCAAACTCCCgtatgcaatttcaattcagttcatta

tttctacagcgct