ATPase, H+ transporting, V1 subunit F

cDNA: Genbank AY648759

 

hi1988 is in the 1st exon

 

tttcttcggcaccccgccttcacgtgagtgacatcaagcgtcggtgtgta

taacgtcattccaggagatgttttggttgttgaacattatttttgtttat

atgcattggaaacgtacaaaatgtgataaaaatcttagtatgagtaaaac

ggggcggatttttatttatttggtaggatttatgcgctgtctcgcattta

ccaaaaaataatttgtatcaggatcagattcgctgtcataatcaccgcac

acaggtcggtcgttaacgcgagcagcacagatctcagatcagctaaataa

ggcgcttacgcgactacgcaaagcggaagtgaagtggtcagctgattaaa

gcatatgatcctgCTGAACGGAAAACATTTCGTCCATTCTGCGTCTTTTA

TTTGAGCAAAATATAAGACAAAGTCACGATGCCCGGACGAGGAAAATTAA

TCGCAGTTATCGGTGATGAAGACACGTGCACCGGATTTC

hi1988 (3-5)

TCCTCGGAGGGATCGGAGAGCTCAATAAAAACCGTAAACCCAATTTCTTG

GTGGTGGAGAAGGAAACCAGCGTTACAGAGATAGAGGAGACCTTCAAgta

agtgacacgatcctaaatgtctgaatgactcaacatcatatattacaatc

taattatcaaatatgcacgttcattaacccacttaaatgtcttttagttt

aacaatattttatatacacctgtaaacacctgtcaatcatatttgcaaga

atctattaaagacatatcaaactattaatattatggattacagtgcagcc

ccaattgacaatttaaatatcctttgtcactattcttcaaactactgatc

aattttgaataatttaaatataagaacatgtttgtccgatctcttcttat

tctgacgatagatcattttgaggaatgtaaacaaaaacaaatgtcccaac

gtattttctgttttacatttttttttatttttgtagcttacgagaatcta

aaaagagcctgcgtattgataaataatgttatgatagcttttttagaatt

aagttattattcaattgtttctttgatatcaagcataggccaatgtcatc

accacaatgaaatggtctatatgaataagtacaagtccaagtcaatatgt

agtttggtatttacataaatatgcaataatgtctgattttgattataatt

tcacccatgcttgcatttaattttcagaagagttatttgaaacatcaaag

tatgcgctgtatatgcatttaatacaataataaaattatattatgtataa

caccttagtagacatacagaaaaaaatgtcttactaacacatatattatg

cattaatatatacagtaaacattacttttcccaataaccttttgaattgt

aatttttggattaacaaatagatgcagagaatagtagatttttgtaattg

tacaattttttttttctgtcaacattaactacagcatgtctgtcgtttat

gactaacagGAGTTTCCTTGCTCGCAATGACATTGGCATCATCCTTATCA

ACCAGTTCATCGCAGAGATGATTCGACATGCCATTGATGCCCACATGCAG

TCCATCCCGGCTGTGCTAGAGATTCCCTCAAAAGAGCATCCATATGATGC

CTCCAAAGACTCCATCCTGCGACGGGCCAAGGGTATGTTCTCTGCAGAGG

ACTTCCGATAACCTGTTACTACCCATGCAGGCTCACAGTCTGGCCTGAGC

AGATGAAGGAGTTGGGTATTCTCATCCATCTCGCTGAAACTGAAAAGCAT

ATTATGAGGAGTAAATAATGATGTGTGTTTAATCAATGTTCTGTGATGTA

TTTTTTGCCATTCCCAAGGAAATAGTTTTTGTCAGTGCTCCTACTAATAA

TTATTTTAAAATATATGTTTAATATAACAATCATATATATCATATATAAA

AATTCAATATATTATGAATTTCCTTTTAAATGCTGTCACTTTAATATTTA

AGTTCCTGAATGTCTTTCTCAAACTTGATAATATTAGACAGAAAACAAAC

TCTCTACATCTGTTACTGTAAATTGGTGTGCTATGCATATATTTTTTCCT

CATTGTATTGGTCATTGTTTTGAAGCATTTCAAAGAAGCTTTCCTCAATG

TGATGCAATTAAAATGTGTTCAAAGTATGTGATTTGCAGTTATTAAAGGT

AATTGGAGTATTATGCTCTATTGatactgtggtgatggaaaataaatatt

aaggtaaaatatgcaa