U2 small nuclear RNA auxiliary factor small subunit (u2af1)

cDNA: Genbank AF506202

 

hi199 and hi2505A are both in the first intron

 

cacccaggaagggttgcaaaatacactgagactttatgttataatgactg

aaatgggaacccatacttaatagtatgataatgctcatcgtgatctccca

acgtctatctttctttccctaaaatgcttccagtccaataggtgacgctg

tgtttgatttaattcttttgtattagtccagcagtgggtgctcactagat

ggcagtagtttgaccctccatcttcagcggcccctgctcttgatcctccg

gcagaagaaaaaaaacccaccgcctttcttctttcaaAATGGCCGAATAC

TTGGCGTCTATTTTCGGTACAGAAAAAGACAAgtaagtagtggtaa

hi2505a (3-5)

ttgt

cgtaaaataatgcttgtgattctttatgctgagcacccctgagcattatt

gcaaaaatttgataattttgaaatttaataattttcagtatttcttttct

tgtgcatcgcgtggtgatgagcagagccgtttgctaaccgcgccgctaac

agcacaacaataatactattaacaaatataattcagatcacaatgctttc

atgtgtaatagattgttatgtgcattttttattgatttgttttacatttg

cgttgttaaatcaagtccagccatgtcttgttagctcctttcattcattg

tggcgccttctcaacgctgtgctaaatggatcttatttaaaagccatatt

tctgtgtttgttttaggttt

hi199 (5-3)

taatagcctatgtttgattaatttgtattttagtatcatttggaagattt

acattaacgtaaatcctaattaagttagttcactattggaattaatacta

gtatcgaatgagcgagtaacgttacgggtggttgaagtgacgaattggtt

cttgtatctaatagtaaacactagtatcgattgaataagtacccctttta

aaagtttactatttactaacgttaatattaggtaatagattagtcttatt

taataaaaaatactaataactaaaaagcaagtgcacgtatcgtgtaaaag

atgcttgtacattatttcgattaaatgttgaaacctattgctatccataa

aattaatatcagcctgtgagagtgatggctaaagttatattgatttagtt

cgaaagcagtttaatgaacagtgttaaataaactctgtttaataaacaaa

ttgttaagagcattgttaatcaaaaagtccagagtgtgtgaacaaaactg

atcaagtgtgtgttttaattcaacagGGTCAACTGCTCTTTCTACTTTAA

AATCGGAGCCTGTCGCCATGGAGACCGATGCTCTAGACTTCATAATAAAC

CCACCTTCAGTCAGgtatctatcagtttttacatcagtgatcctgtaatc

tatgatgtttctgctagatttatgttgtgattgacatctgatatgtgttg

cagACCATTGCCCTGTTGAACATCTACAGGAACCCACAAAACACAGCCCA

GTCTGCTGATGGCTTAAgtaagtcctactcctgtattaggattaagtgat

gtcctgcaatccggagataagagcatgcacggtcctgattacagttgttt

tatataatgtatatttataatttactcaactttcacttattccaaaccta

gcttctctcttctgttgagcacaaattgagatatttggagagagctgaaa

tcctgtaactaaattgactttcatagtatttacttctcctgttatggaca

tcagtttccacaatctttaaagtatcttctttgtgttcaaaagaataaaa

ttataaataaacttgagggatagtaaattttcatttttggtaaactaccc

atttaacagcacatttataatattatacataaaaattaaacattcacaaa

acctg